Added predetermined headers feature

Instead of generating a tuple comprised of the one sequence ID repeated

.devcontainer/Dockerfile

@@ -0,0 +1,11 @@
+FROM mcr.microsoft.com/devcontainers/anaconda:1-3
+
+# Copy environment.yml (if found) to a temp location so we update the environment. Also
+# copy "noop.txt" so the COPY instruction does not fail if no environment.yml exists.
+COPY environment.yml* .devcontainer/noop.txt /tmp/conda-tmp/
+RUN if [ -f "/tmp/conda-tmp/environment.yml" ]; then umask 0002 && /opt/conda/bin/conda env update -n base -f /tmp/conda-tmp/environment.yml; fi \
+    && rm -rf /tmp/conda-tmp
+
+# [Optional] Uncomment this section to install additional OS packages.
+# RUN apt-get update && export DEBIAN_FRONTEND=noninteractive \
+#     && apt-get -y install --no-install-recommends <your-package-list-here>

.devcontainer/devcontainer.json

@@ -1,9 +1,11 @@
 // For format details, see https://aka.ms/devcontainer.json. For config options, see the
-// README at: https://github.com/devcontainers/templates/tree/main/src/python
+// README at: https://github.com/devcontainers/templates/tree/main/src/anaconda
 {
-	"name": "Python 3",
-	// Or use a Dockerfile or Docker Compose file. More info: https://containers.dev/guide/dockerfile
-	"image": "mcr.microsoft.com/devcontainers/python:1-3.12-bullseye",
+	"name": "Anaconda (Python 3)",
+	"build": { 
+		"context": "..",
+		"dockerfile": "Dockerfile"
+	}
 
 	// Features to add to the dev container. More info: https://containers.dev/features.
 	// "features": {},
@@ -12,14 +14,7 @@
 	// "forwardPorts": [],
 
 	// Use 'postCreateCommand' to run commands after the container is created.
-	"postCreateCommand": "pip3 install --user -r requirements.txt",
-	"customizations": {
-		"vscode": {
-			"extensions": [
-				"mechatroner.rainbow-csv"
-			]
-		}
-	}
+	// "postCreateCommand": "python --version",
 
 	// Configure tool-specific properties.
 	// "customizations": {},

.devcontainer/noop.txt

@@ -0,0 +1,3 @@
+This file copied into the container along with environment.yml* from the parent
+folder. This file is included to prevents the Dockerfile COPY instruction from 
+failing if no environment.yml is found.

.gitignore

@@ -1,6 +1,6 @@
 # File created using '.gitignore Generator' for Visual Studio Code: https://bit.ly/vscode-gig
-# Created by https://www.toptal.com/developers/gitignore/api/visualstudiocode,svelte,python,linux,node
-# Edit at https://www.toptal.com/developers/gitignore?templates=visualstudiocode,svelte,python,linux,node
+# Created by https://www.toptal.com/developers/gitignore/api/visualstudiocode,linux,python
+# Edit at https://www.toptal.com/developers/gitignore?templates=visualstudiocode,linux,python
 
 ### Linux ###
 *~
@@ -17,146 +17,6 @@
 # .nfs files are created when an open file is removed but is still being accessed
 .nfs*
 
-### Node ###
-# Logs
-logs
-*.log
-npm-debug.log*
-yarn-debug.log*
-yarn-error.log*
-lerna-debug.log*
-.pnpm-debug.log*
-
-# Diagnostic reports (https://nodejs.org/api/report.html)
-report.[0-9]*.[0-9]*.[0-9]*.[0-9]*.json
-
-# Runtime data
-pids
-*.pid
-*.seed
-*.pid.lock
-
-# Directory for instrumented libs generated by jscoverage/JSCover
-lib-cov
-
-# Coverage directory used by tools like istanbul
-coverage
-*.lcov
-
-# nyc test coverage
-.nyc_output
-
-# Grunt intermediate storage (https://gruntjs.com/creating-plugins#storing-task-files)
-.grunt
-
-# Bower dependency directory (https://bower.io/)
-bower_components
-
-# node-waf configuration
-.lock-wscript
-
-# Compiled binary addons (https://nodejs.org/api/addons.html)
-build/Release
-
-# Dependency directories
-node_modules/
-jspm_packages/
-
-# Snowpack dependency directory (https://snowpack.dev/)
-web_modules/
-
-# TypeScript cache
-*.tsbuildinfo
-
-# Optional npm cache directory
-.npm
-
-# Optional eslint cache
-.eslintcache
-
-# Optional stylelint cache
-.stylelintcache
-
-# Microbundle cache
-.rpt2_cache/
-.rts2_cache_cjs/
-.rts2_cache_es/
-.rts2_cache_umd/
-
-# Optional REPL history
-.node_repl_history
-
-# Output of 'npm pack'
-*.tgz
-
-# Yarn Integrity file
-.yarn-integrity
-
-# dotenv environment variable files
-.env
-.env.development.local
-.env.test.local
-.env.production.local
-.env.local
-
-# parcel-bundler cache (https://parceljs.org/)
-.cache
-.parcel-cache
-
-# Next.js build output
-.next
-out
-
-# Nuxt.js build / generate output
-.nuxt
-dist
-
-# Gatsby files
-.cache/
-# Comment in the public line in if your project uses Gatsby and not Next.js
-# https://nextjs.org/blog/next-9-1#public-directory-support
-# public
-
-# vuepress build output
-.vuepress/dist
-
-# vuepress v2.x temp and cache directory
-.temp
-
-# Docusaurus cache and generated files
-.docusaurus
-
-# Serverless directories
-.serverless/
-
-# FuseBox cache
-.fusebox/
-
-# DynamoDB Local files
-.dynamodb/
-
-# TernJS port file
-.tern-port
-
-# Stores VSCode versions used for testing VSCode extensions
-.vscode-test
-
-# yarn v2
-.yarn/cache
-.yarn/unplugged
-.yarn/build-state.yml
-.yarn/install-state.gz
-.pnp.*
-
-### Node Patch ###
-# Serverless Webpack directories
-.webpack/
-
-# Optional stylelint cache
-
-# SvelteKit build / generate output
-.svelte-kit
-
 ### Python ###
 # Byte-compiled / optimized / DLL files
 __pycache__/
@@ -202,6 +62,7 @@ htmlcov/
 .nox/
 .coverage
 .coverage.*
+.cache
 nosetests.xml
 coverage.xml
 *.cover
@@ -215,6 +76,7 @@ cover/
 *.pot
 
 # Django stuff:
+*.log
 local_settings.py
 db.sqlite3
 db.sqlite3-journal
@@ -278,6 +140,7 @@ celerybeat.pid
 *.sage.py
 
 # Environments
+.env
 .venv
 env/
 venv/
@@ -326,13 +189,6 @@ poetry.toml
 # LSP config files
 pyrightconfig.json
 
-### Svelte ###
-# gitignore template for the SvelteKit, frontend web component framework
-# website: https://kit.svelte.dev/
-
-.svelte-kit/
-package
-
 ### VisualStudioCode ###
 .vscode/*
 !.vscode/settings.json
@@ -352,8 +208,8 @@ package
 .history
 .ionide
 
-# End of https://www.toptal.com/developers/gitignore/api/visualstudiocode,svelte,python,linux,node
+# End of https://www.toptal.com/developers/gitignore/api/visualstudiocode,linux,python
 
 # Custom rules (everything added below won't be overriden by 'Generate .gitignore File' if you use 'Update' option)
 
-output
+conda-bld

.vscode/extensions.json

@@ -0,0 +1,6 @@
+{
+    "recommendations": [
+        "piotrpalarz.vscode-gitignore-generator",
+        "gruntfuggly.todo-tree"
+    ]
+}

.vscode/launch.json

@@ -1,25 +0,0 @@
-{
-    // Use IntelliSense to learn about possible attributes.
-    // Hover to view descriptions of existing attributes.
-    // For more information, visit: https://go.microsoft.com/fwlink/?linkid=830387
-    "version": "0.2.0",
-    "configurations": [
-        
-        {
-            "name": "automlst info -lschema pubmlst_bordetella_seqdef",
-            "type": "debugpy",
-            "request": "launch",
-            "program": "${workspaceFolder}/src/automlst/cli/program.py",
-            "console": "integratedTerminal",
-            "args": [
-                "info",
-                "-lschemas",
-                "pubmlst_bordetella_seqdef"
-            ],
-            "cwd": "${workspaceFolder}/src",
-            "env": {
-                "PYTHONPATH": "${workspaceFolder}/src"
-            }
-        }
-    ]
-}

Jenkinsfile

@@ -2,47 +2,64 @@ pipeline {
     agent {
         kubernetes {
             cloud 'rsys-devel'
-            defaultContainer 'pip'
-            inheritFrom 'pip'
+            defaultContainer 'miniforge3'
+            inheritFrom 'miniforge'
         }
     }
     stages {
         stage("install") {
             steps {
-                sh 'python -m pip install -r requirements.txt'
+                sh 'conda env update -n base -f environment.yml'
             }
         }
         stage("unit tests") {
             steps {
-                sh returnStatus: true, script: "python -m pytest --junitxml=test_results.xml"
+                sh returnStatus: true, script: "python -m pytest --junitxml=test_results.xml --cov=src --cov-report xml:coverage.xml"
                 xunit checksName: '', tools: [JUnit(excludesPattern: '', pattern: 'test_results.xml', stopProcessingIfError: true)]
+                recordCoverage(tools: [[parser: 'COBERTURA', pattern: 'coverage.xml']])
             }
         }
         stage("build") {
             steps {
                 sh "python -m build"
-            }
-        }
-        stage("test installation") {
-            steps {
-                sh "python -m pip install dist/*.whl --force-reinstall"
-                sh "automlst -h"
+                sh "grayskull pypi dist/*.tar.gz --maintainers 'Harrison Deng'"
+                sh "python scripts/patch_recipe.py"
+                sh 'conda build autobigs-engine -c bioconda --output-folder conda-bld --verify'
             }
         }
         stage("archive") {
             steps {
-                archiveArtifacts artifacts: 'dist/*.tar.gz, dist/*.whl', fingerprint: true, followSymlinks: false, onlyIfSuccessful: true
+                archiveArtifacts artifacts: 'dist/*.tar.gz, dist/*.whl, conda-bld/**/*.conda', fingerprint: true, followSymlinks: false, onlyIfSuccessful: true
             }
         }
         stage("publish") {
-            environment {
-                CREDS = credentials('4d6f64be-d26d-4f95-8de3-b6a9b0beb311')
-            }
-            when {
-                branch '**/main'
-            }
-            steps {
-                sh returnStatus: true, script: 'python -m twine upload --repository-url https://git.reslate.systems/api/packages/${CREDS_USR}/pypi -u ${CREDS_USR} -p ${CREDS_PSW} --non-interactive --disable-progress-bar --verbose dist/*'
+            parallel {
+                stage ("git.reslate.systems") {
+                    when {
+                        not {
+                            tag '*.*.*'
+                        }
+                    }
+
+                    environment {
+                        CREDS = credentials('username-password-rs-git')
+                    }
+                    steps {
+                        sh 'python -m twine upload --repository-url https://git.reslate.systems/api/packages/ydeng/pypi -u ${CREDS_USR} -p ${CREDS_PSW} --non-interactive --disable-progress-bar --verbose dist/*'
+                        sh 'curl --user ${CREDS_USR}:${CREDS_PSW} --upload-file conda-bld/**/*.conda https://git.reslate.systems/api/packages/${CREDS_USR}/conda/$(basename conda-bld/**/*.conda)'
+                    }
+                }
+                stage ("pypi.org") {
+                    when {
+                        tag '*.*.*'
+                    }
+                    environment {
+                        TOKEN = credentials('pypi.org')
+                    }
+                    steps {
+                        sh returnStatus: true, script: 'python -m twine upload -u __token__ -p ${TOKEN} --non-interactive --disable-progress-bar --verbose dist/*'
+                    }
+                }
             }
         }
     }

LICENSE

@@ -0,0 +1,674 @@
+                    GNU GENERAL PUBLIC LICENSE
+                       Version 3, 29 June 2007
+
+ Copyright (C) 2007 Free Software Foundation, Inc. <https://fsf.org/>
+ Everyone is permitted to copy and distribute verbatim copies
+ of this license document, but changing it is not allowed.
+
+                            Preamble
+
+  The GNU General Public License is a free, copyleft license for
+software and other kinds of works.
+
+  The licenses for most software and other practical works are designed
+to take away your freedom to share and change the works.  By contrast,
+the GNU General Public License is intended to guarantee your freedom to
+share and change all versions of a program--to make sure it remains free
+software for all its users.  We, the Free Software Foundation, use the
+GNU General Public License for most of our software; it applies also to
+any other work released this way by its authors.  You can apply it to
+your programs, too.
+
+  When we speak of free software, we are referring to freedom, not
+price.  Our General Public Licenses are designed to make sure that you
+have the freedom to distribute copies of free software (and charge for
+them if you wish), that you receive source code or can get it if you
+want it, that you can change the software or use pieces of it in new
+free programs, and that you know you can do these things.
+
+  To protect your rights, we need to prevent others from denying you
+these rights or asking you to surrender the rights.  Therefore, you have
+certain responsibilities if you distribute copies of the software, or if
+you modify it: responsibilities to respect the freedom of others.
+
+  For example, if you distribute copies of such a program, whether
+gratis or for a fee, you must pass on to the recipients the same
+freedoms that you received.  You must make sure that they, too, receive
+or can get the source code.  And you must show them these terms so they
+know their rights.
+
+  Developers that use the GNU GPL protect your rights with two steps:
+(1) assert copyright on the software, and (2) offer you this License
+giving you legal permission to copy, distribute and/or modify it.
+
+  For the developers' and authors' protection, the GPL clearly explains
+that there is no warranty for this free software.  For both users' and
+authors' sake, the GPL requires that modified versions be marked as
+changed, so that their problems will not be attributed erroneously to
+authors of previous versions.
+
+  Some devices are designed to deny users access to install or run
+modified versions of the software inside them, although the manufacturer
+can do so.  This is fundamentally incompatible with the aim of
+protecting users' freedom to change the software.  The systematic
+pattern of such abuse occurs in the area of products for individuals to
+use, which is precisely where it is most unacceptable.  Therefore, we
+have designed this version of the GPL to prohibit the practice for those
+products.  If such problems arise substantially in other domains, we
+stand ready to extend this provision to those domains in future versions
+of the GPL, as needed to protect the freedom of users.
+
+  Finally, every program is threatened constantly by software patents.
+States should not allow patents to restrict development and use of
+software on general-purpose computers, but in those that do, we wish to
+avoid the special danger that patents applied to a free program could
+make it effectively proprietary.  To prevent this, the GPL assures that
+patents cannot be used to render the program non-free.
+
+  The precise terms and conditions for copying, distribution and
+modification follow.
+
+                       TERMS AND CONDITIONS
+
+  0. Definitions.
+
+  "This License" refers to version 3 of the GNU General Public License.
+
+  "Copyright" also means copyright-like laws that apply to other kinds of
+works, such as semiconductor masks.
+
+  "The Program" refers to any copyrightable work licensed under this
+License.  Each licensee is addressed as "you".  "Licensees" and
+"recipients" may be individuals or organizations.
+
+  To "modify" a work means to copy from or adapt all or part of the work
+in a fashion requiring copyright permission, other than the making of an
+exact copy.  The resulting work is called a "modified version" of the
+earlier work or a work "based on" the earlier work.
+
+  A "covered work" means either the unmodified Program or a work based
+on the Program.
+
+  To "propagate" a work means to do anything with it that, without
+permission, would make you directly or secondarily liable for
+infringement under applicable copyright law, except executing it on a
+computer or modifying a private copy.  Propagation includes copying,
+distribution (with or without modification), making available to the
+public, and in some countries other activities as well.
+
+  To "convey" a work means any kind of propagation that enables other
+parties to make or receive copies.  Mere interaction with a user through
+a computer network, with no transfer of a copy, is not conveying.
+
+  An interactive user interface displays "Appropriate Legal Notices"
+to the extent that it includes a convenient and prominently visible
+feature that (1) displays an appropriate copyright notice, and (2)
+tells the user that there is no warranty for the work (except to the
+extent that warranties are provided), that licensees may convey the
+work under this License, and how to view a copy of this License.  If
+the interface presents a list of user commands or options, such as a
+menu, a prominent item in the list meets this criterion.
+
+  1. Source Code.
+
+  The "source code" for a work means the preferred form of the work
+for making modifications to it.  "Object code" means any non-source
+form of a work.
+
+  A "Standard Interface" means an interface that either is an official
+standard defined by a recognized standards body, or, in the case of
+interfaces specified for a particular programming language, one that
+is widely used among developers working in that language.
+
+  The "System Libraries" of an executable work include anything, other
+than the work as a whole, that (a) is included in the normal form of
+packaging a Major Component, but which is not part of that Major
+Component, and (b) serves only to enable use of the work with that
+Major Component, or to implement a Standard Interface for which an
+implementation is available to the public in source code form.  A
+"Major Component", in this context, means a major essential component
+(kernel, window system, and so on) of the specific operating system
+(if any) on which the executable work runs, or a compiler used to
+produce the work, or an object code interpreter used to run it.
+
+  The "Corresponding Source" for a work in object code form means all
+the source code needed to generate, install, and (for an executable
+work) run the object code and to modify the work, including scripts to
+control those activities.  However, it does not include the work's
+System Libraries, or general-purpose tools or generally available free
+programs which are used unmodified in performing those activities but
+which are not part of the work.  For example, Corresponding Source
+includes interface definition files associated with source files for
+the work, and the source code for shared libraries and dynamically
+linked subprograms that the work is specifically designed to require,
+such as by intimate data communication or control flow between those
+subprograms and other parts of the work.
+
+  The Corresponding Source need not include anything that users
+can regenerate automatically from other parts of the Corresponding
+Source.
+
+  The Corresponding Source for a work in source code form is that
+same work.
+
+  2. Basic Permissions.
+
+  All rights granted under this License are granted for the term of
+copyright on the Program, and are irrevocable provided the stated
+conditions are met.  This License explicitly affirms your unlimited
+permission to run the unmodified Program.  The output from running a
+covered work is covered by this License only if the output, given its
+content, constitutes a covered work.  This License acknowledges your
+rights of fair use or other equivalent, as provided by copyright law.
+
+  You may make, run and propagate covered works that you do not
+convey, without conditions so long as your license otherwise remains
+in force.  You may convey covered works to others for the sole purpose
+of having them make modifications exclusively for you, or provide you
+with facilities for running those works, provided that you comply with
+the terms of this License in conveying all material for which you do
+not control copyright.  Those thus making or running the covered works
+for you must do so exclusively on your behalf, under your direction
+and control, on terms that prohibit them from making any copies of
+your copyrighted material outside their relationship with you.
+
+  Conveying under any other circumstances is permitted solely under
+the conditions stated below.  Sublicensing is not allowed; section 10
+makes it unnecessary.
+
+  3. Protecting Users' Legal Rights From Anti-Circumvention Law.
+
+  No covered work shall be deemed part of an effective technological
+measure under any applicable law fulfilling obligations under article
+11 of the WIPO copyright treaty adopted on 20 December 1996, or
+similar laws prohibiting or restricting circumvention of such
+measures.
+
+  When you convey a covered work, you waive any legal power to forbid
+circumvention of technological measures to the extent such circumvention
+is effected by exercising rights under this License with respect to
+the covered work, and you disclaim any intention to limit operation or
+modification of the work as a means of enforcing, against the work's
+users, your or third parties' legal rights to forbid circumvention of
+technological measures.
+
+  4. Conveying Verbatim Copies.
+
+  You may convey verbatim copies of the Program's source code as you
+receive it, in any medium, provided that you conspicuously and
+appropriately publish on each copy an appropriate copyright notice;
+keep intact all notices stating that this License and any
+non-permissive terms added in accord with section 7 apply to the code;
+keep intact all notices of the absence of any warranty; and give all
+recipients a copy of this License along with the Program.
+
+  You may charge any price or no price for each copy that you convey,
+and you may offer support or warranty protection for a fee.
+
+  5. Conveying Modified Source Versions.
+
+  You may convey a work based on the Program, or the modifications to
+produce it from the Program, in the form of source code under the
+terms of section 4, provided that you also meet all of these conditions:
+
+    a) The work must carry prominent notices stating that you modified
+    it, and giving a relevant date.
+
+    b) The work must carry prominent notices stating that it is
+    released under this License and any conditions added under section
+    7.  This requirement modifies the requirement in section 4 to
+    "keep intact all notices".
+
+    c) You must license the entire work, as a whole, under this
+    License to anyone who comes into possession of a copy.  This
+    License will therefore apply, along with any applicable section 7
+    additional terms, to the whole of the work, and all its parts,
+    regardless of how they are packaged.  This License gives no
+    permission to license the work in any other way, but it does not
+    invalidate such permission if you have separately received it.
+
+    d) If the work has interactive user interfaces, each must display
+    Appropriate Legal Notices; however, if the Program has interactive
+    interfaces that do not display Appropriate Legal Notices, your
+    work need not make them do so.
+
+  A compilation of a covered work with other separate and independent
+works, which are not by their nature extensions of the covered work,
+and which are not combined with it such as to form a larger program,
+in or on a volume of a storage or distribution medium, is called an
+"aggregate" if the compilation and its resulting copyright are not
+used to limit the access or legal rights of the compilation's users
+beyond what the individual works permit.  Inclusion of a covered work
+in an aggregate does not cause this License to apply to the other
+parts of the aggregate.
+
+  6. Conveying Non-Source Forms.
+
+  You may convey a covered work in object code form under the terms
+of sections 4 and 5, provided that you also convey the
+machine-readable Corresponding Source under the terms of this License,
+in one of these ways:
+
+    a) Convey the object code in, or embodied in, a physical product
+    (including a physical distribution medium), accompanied by the
+    Corresponding Source fixed on a durable physical medium
+    customarily used for software interchange.
+
+    b) Convey the object code in, or embodied in, a physical product
+    (including a physical distribution medium), accompanied by a
+    written offer, valid for at least three years and valid for as
+    long as you offer spare parts or customer support for that product
+    model, to give anyone who possesses the object code either (1) a
+    copy of the Corresponding Source for all the software in the
+    product that is covered by this License, on a durable physical
+    medium customarily used for software interchange, for a price no
+    more than your reasonable cost of physically performing this
+    conveying of source, or (2) access to copy the
+    Corresponding Source from a network server at no charge.
+
+    c) Convey individual copies of the object code with a copy of the
+    written offer to provide the Corresponding Source.  This
+    alternative is allowed only occasionally and noncommercially, and
+    only if you received the object code with such an offer, in accord
+    with subsection 6b.
+
+    d) Convey the object code by offering access from a designated
+    place (gratis or for a charge), and offer equivalent access to the
+    Corresponding Source in the same way through the same place at no
+    further charge.  You need not require recipients to copy the
+    Corresponding Source along with the object code.  If the place to
+    copy the object code is a network server, the Corresponding Source
+    may be on a different server (operated by you or a third party)
+    that supports equivalent copying facilities, provided you maintain
+    clear directions next to the object code saying where to find the
+    Corresponding Source.  Regardless of what server hosts the
+    Corresponding Source, you remain obligated to ensure that it is
+    available for as long as needed to satisfy these requirements.
+
+    e) Convey the object code using peer-to-peer transmission, provided
+    you inform other peers where the object code and Corresponding
+    Source of the work are being offered to the general public at no
+    charge under subsection 6d.
+
+  A separable portion of the object code, whose source code is excluded
+from the Corresponding Source as a System Library, need not be
+included in conveying the object code work.
+
+  A "User Product" is either (1) a "consumer product", which means any
+tangible personal property which is normally used for personal, family,
+or household purposes, or (2) anything designed or sold for incorporation
+into a dwelling.  In determining whether a product is a consumer product,
+doubtful cases shall be resolved in favor of coverage.  For a particular
+product received by a particular user, "normally used" refers to a
+typical or common use of that class of product, regardless of the status
+of the particular user or of the way in which the particular user
+actually uses, or expects or is expected to use, the product.  A product
+is a consumer product regardless of whether the product has substantial
+commercial, industrial or non-consumer uses, unless such uses represent
+the only significant mode of use of the product.
+
+  "Installation Information" for a User Product means any methods,
+procedures, authorization keys, or other information required to install
+and execute modified versions of a covered work in that User Product from
+a modified version of its Corresponding Source.  The information must
+suffice to ensure that the continued functioning of the modified object
+code is in no case prevented or interfered with solely because
+modification has been made.
+
+  If you convey an object code work under this section in, or with, or
+specifically for use in, a User Product, and the conveying occurs as
+part of a transaction in which the right of possession and use of the
+User Product is transferred to the recipient in perpetuity or for a
+fixed term (regardless of how the transaction is characterized), the
+Corresponding Source conveyed under this section must be accompanied
+by the Installation Information.  But this requirement does not apply
+if neither you nor any third party retains the ability to install
+modified object code on the User Product (for example, the work has
+been installed in ROM).
+
+  The requirement to provide Installation Information does not include a
+requirement to continue to provide support service, warranty, or updates
+for a work that has been modified or installed by the recipient, or for
+the User Product in which it has been modified or installed.  Access to a
+network may be denied when the modification itself materially and
+adversely affects the operation of the network or violates the rules and
+protocols for communication across the network.
+
+  Corresponding Source conveyed, and Installation Information provided,
+in accord with this section must be in a format that is publicly
+documented (and with an implementation available to the public in
+source code form), and must require no special password or key for
+unpacking, reading or copying.
+
+  7. Additional Terms.
+
+  "Additional permissions" are terms that supplement the terms of this
+License by making exceptions from one or more of its conditions.
+Additional permissions that are applicable to the entire Program shall
+be treated as though they were included in this License, to the extent
+that they are valid under applicable law.  If additional permissions
+apply only to part of the Program, that part may be used separately
+under those permissions, but the entire Program remains governed by
+this License without regard to the additional permissions.
+
+  When you convey a copy of a covered work, you may at your option
+remove any additional permissions from that copy, or from any part of
+it.  (Additional permissions may be written to require their own
+removal in certain cases when you modify the work.)  You may place
+additional permissions on material, added by you to a covered work,
+for which you have or can give appropriate copyright permission.
+
+  Notwithstanding any other provision of this License, for material you
+add to a covered work, you may (if authorized by the copyright holders of
+that material) supplement the terms of this License with terms:
+
+    a) Disclaiming warranty or limiting liability differently from the
+    terms of sections 15 and 16 of this License; or
+
+    b) Requiring preservation of specified reasonable legal notices or
+    author attributions in that material or in the Appropriate Legal
+    Notices displayed by works containing it; or
+
+    c) Prohibiting misrepresentation of the origin of that material, or
+    requiring that modified versions of such material be marked in
+    reasonable ways as different from the original version; or
+
+    d) Limiting the use for publicity purposes of names of licensors or
+    authors of the material; or
+
+    e) Declining to grant rights under trademark law for use of some
+    trade names, trademarks, or service marks; or
+
+    f) Requiring indemnification of licensors and authors of that
+    material by anyone who conveys the material (or modified versions of
+    it) with contractual assumptions of liability to the recipient, for
+    any liability that these contractual assumptions directly impose on
+    those licensors and authors.
+
+  All other non-permissive additional terms are considered "further
+restrictions" within the meaning of section 10.  If the Program as you
+received it, or any part of it, contains a notice stating that it is
+governed by this License along with a term that is a further
+restriction, you may remove that term.  If a license document contains
+a further restriction but permits relicensing or conveying under this
+License, you may add to a covered work material governed by the terms
+of that license document, provided that the further restriction does
+not survive such relicensing or conveying.
+
+  If you add terms to a covered work in accord with this section, you
+must place, in the relevant source files, a statement of the
+additional terms that apply to those files, or a notice indicating
+where to find the applicable terms.
+
+  Additional terms, permissive or non-permissive, may be stated in the
+form of a separately written license, or stated as exceptions;
+the above requirements apply either way.
+
+  8. Termination.
+
+  You may not propagate or modify a covered work except as expressly
+provided under this License.  Any attempt otherwise to propagate or
+modify it is void, and will automatically terminate your rights under
+this License (including any patent licenses granted under the third
+paragraph of section 11).
+
+  However, if you cease all violation of this License, then your
+license from a particular copyright holder is reinstated (a)
+provisionally, unless and until the copyright holder explicitly and
+finally terminates your license, and (b) permanently, if the copyright
+holder fails to notify you of the violation by some reasonable means
+prior to 60 days after the cessation.
+
+  Moreover, your license from a particular copyright holder is
+reinstated permanently if the copyright holder notifies you of the
+violation by some reasonable means, this is the first time you have
+received notice of violation of this License (for any work) from that
+copyright holder, and you cure the violation prior to 30 days after
+your receipt of the notice.
+
+  Termination of your rights under this section does not terminate the
+licenses of parties who have received copies or rights from you under
+this License.  If your rights have been terminated and not permanently
+reinstated, you do not qualify to receive new licenses for the same
+material under section 10.
+
+  9. Acceptance Not Required for Having Copies.
+
+  You are not required to accept this License in order to receive or
+run a copy of the Program.  Ancillary propagation of a covered work
+occurring solely as a consequence of using peer-to-peer transmission
+to receive a copy likewise does not require acceptance.  However,
+nothing other than this License grants you permission to propagate or
+modify any covered work.  These actions infringe copyright if you do
+not accept this License.  Therefore, by modifying or propagating a
+covered work, you indicate your acceptance of this License to do so.
+
+  10. Automatic Licensing of Downstream Recipients.
+
+  Each time you convey a covered work, the recipient automatically
+receives a license from the original licensors, to run, modify and
+propagate that work, subject to this License.  You are not responsible
+for enforcing compliance by third parties with this License.
+
+  An "entity transaction" is a transaction transferring control of an
+organization, or substantially all assets of one, or subdividing an
+organization, or merging organizations.  If propagation of a covered
+work results from an entity transaction, each party to that
+transaction who receives a copy of the work also receives whatever
+licenses to the work the party's predecessor in interest had or could
+give under the previous paragraph, plus a right to possession of the
+Corresponding Source of the work from the predecessor in interest, if
+the predecessor has it or can get it with reasonable efforts.
+
+  You may not impose any further restrictions on the exercise of the
+rights granted or affirmed under this License.  For example, you may
+not impose a license fee, royalty, or other charge for exercise of
+rights granted under this License, and you may not initiate litigation
+(including a cross-claim or counterclaim in a lawsuit) alleging that
+any patent claim is infringed by making, using, selling, offering for
+sale, or importing the Program or any portion of it.
+
+  11. Patents.
+
+  A "contributor" is a copyright holder who authorizes use under this
+License of the Program or a work on which the Program is based.  The
+work thus licensed is called the contributor's "contributor version".
+
+  A contributor's "essential patent claims" are all patent claims
+owned or controlled by the contributor, whether already acquired or
+hereafter acquired, that would be infringed by some manner, permitted
+by this License, of making, using, or selling its contributor version,
+but do not include claims that would be infringed only as a
+consequence of further modification of the contributor version.  For
+purposes of this definition, "control" includes the right to grant
+patent sublicenses in a manner consistent with the requirements of
+this License.
+
+  Each contributor grants you a non-exclusive, worldwide, royalty-free
+patent license under the contributor's essential patent claims, to
+make, use, sell, offer for sale, import and otherwise run, modify and
+propagate the contents of its contributor version.
+
+  In the following three paragraphs, a "patent license" is any express
+agreement or commitment, however denominated, not to enforce a patent
+(such as an express permission to practice a patent or covenant not to
+sue for patent infringement).  To "grant" such a patent license to a
+party means to make such an agreement or commitment not to enforce a
+patent against the party.
+
+  If you convey a covered work, knowingly relying on a patent license,
+and the Corresponding Source of the work is not available for anyone
+to copy, free of charge and under the terms of this License, through a
+publicly available network server or other readily accessible means,
+then you must either (1) cause the Corresponding Source to be so
+available, or (2) arrange to deprive yourself of the benefit of the
+patent license for this particular work, or (3) arrange, in a manner
+consistent with the requirements of this License, to extend the patent
+license to downstream recipients.  "Knowingly relying" means you have
+actual knowledge that, but for the patent license, your conveying the
+covered work in a country, or your recipient's use of the covered work
+in a country, would infringe one or more identifiable patents in that
+country that you have reason to believe are valid.
+
+  If, pursuant to or in connection with a single transaction or
+arrangement, you convey, or propagate by procuring conveyance of, a
+covered work, and grant a patent license to some of the parties
+receiving the covered work authorizing them to use, propagate, modify
+or convey a specific copy of the covered work, then the patent license
+you grant is automatically extended to all recipients of the covered
+work and works based on it.
+
+  A patent license is "discriminatory" if it does not include within
+the scope of its coverage, prohibits the exercise of, or is
+conditioned on the non-exercise of one or more of the rights that are
+specifically granted under this License.  You may not convey a covered
+work if you are a party to an arrangement with a third party that is
+in the business of distributing software, under which you make payment
+to the third party based on the extent of your activity of conveying
+the work, and under which the third party grants, to any of the
+parties who would receive the covered work from you, a discriminatory
+patent license (a) in connection with copies of the covered work
+conveyed by you (or copies made from those copies), or (b) primarily
+for and in connection with specific products or compilations that
+contain the covered work, unless you entered into that arrangement,
+or that patent license was granted, prior to 28 March 2007.
+
+  Nothing in this License shall be construed as excluding or limiting
+any implied license or other defenses to infringement that may
+otherwise be available to you under applicable patent law.
+
+  12. No Surrender of Others' Freedom.
+
+  If conditions are imposed on you (whether by court order, agreement or
+otherwise) that contradict the conditions of this License, they do not
+excuse you from the conditions of this License.  If you cannot convey a
+covered work so as to satisfy simultaneously your obligations under this
+License and any other pertinent obligations, then as a consequence you may
+not convey it at all.  For example, if you agree to terms that obligate you
+to collect a royalty for further conveying from those to whom you convey
+the Program, the only way you could satisfy both those terms and this
+License would be to refrain entirely from conveying the Program.
+
+  13. Use with the GNU Affero General Public License.
+
+  Notwithstanding any other provision of this License, you have
+permission to link or combine any covered work with a work licensed
+under version 3 of the GNU Affero General Public License into a single
+combined work, and to convey the resulting work.  The terms of this
+License will continue to apply to the part which is the covered work,
+but the special requirements of the GNU Affero General Public License,
+section 13, concerning interaction through a network will apply to the
+combination as such.
+
+  14. Revised Versions of this License.
+
+  The Free Software Foundation may publish revised and/or new versions of
+the GNU General Public License from time to time.  Such new versions will
+be similar in spirit to the present version, but may differ in detail to
+address new problems or concerns.
+
+  Each version is given a distinguishing version number.  If the
+Program specifies that a certain numbered version of the GNU General
+Public License "or any later version" applies to it, you have the
+option of following the terms and conditions either of that numbered
+version or of any later version published by the Free Software
+Foundation.  If the Program does not specify a version number of the
+GNU General Public License, you may choose any version ever published
+by the Free Software Foundation.
+
+  If the Program specifies that a proxy can decide which future
+versions of the GNU General Public License can be used, that proxy's
+public statement of acceptance of a version permanently authorizes you
+to choose that version for the Program.
+
+  Later license versions may give you additional or different
+permissions.  However, no additional obligations are imposed on any
+author or copyright holder as a result of your choosing to follow a
+later version.
+
+  15. Disclaimer of Warranty.
+
+  THERE IS NO WARRANTY FOR THE PROGRAM, TO THE EXTENT PERMITTED BY
+APPLICABLE LAW.  EXCEPT WHEN OTHERWISE STATED IN WRITING THE COPYRIGHT
+HOLDERS AND/OR OTHER PARTIES PROVIDE THE PROGRAM "AS IS" WITHOUT WARRANTY
+OF ANY KIND, EITHER EXPRESSED OR IMPLIED, INCLUDING, BUT NOT LIMITED TO,
+THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
+PURPOSE.  THE ENTIRE RISK AS TO THE QUALITY AND PERFORMANCE OF THE PROGRAM
+IS WITH YOU.  SHOULD THE PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF
+ALL NECESSARY SERVICING, REPAIR OR CORRECTION.
+
+  16. Limitation of Liability.
+
+  IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN WRITING
+WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MODIFIES AND/OR CONVEYS
+THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU FOR DAMAGES, INCLUDING ANY
+GENERAL, SPECIAL, INCIDENTAL OR CONSEQUENTIAL DAMAGES ARISING OUT OF THE
+USE OR INABILITY TO USE THE PROGRAM (INCLUDING BUT NOT LIMITED TO LOSS OF
+DATA OR DATA BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD
+PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER PROGRAMS),
+EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE POSSIBILITY OF
+SUCH DAMAGES.
+
+  17. Interpretation of Sections 15 and 16.
+
+  If the disclaimer of warranty and limitation of liability provided
+above cannot be given local legal effect according to their terms,
+reviewing courts shall apply local law that most closely approximates
+an absolute waiver of all civil liability in connection with the
+Program, unless a warranty or assumption of liability accompanies a
+copy of the Program in return for a fee.
+
+                     END OF TERMS AND CONDITIONS
+
+            How to Apply These Terms to Your New Programs
+
+  If you develop a new program, and you want it to be of the greatest
+possible use to the public, the best way to achieve this is to make it
+free software which everyone can redistribute and change under these terms.
+
+  To do so, attach the following notices to the program.  It is safest
+to attach them to the start of each source file to most effectively
+state the exclusion of warranty; and each file should have at least
+the "copyright" line and a pointer to where the full notice is found.
+
+    <one line to give the program's name and a brief idea of what it does.>
+    Copyright (C) <year>  <name of author>
+
+    This program is free software: you can redistribute it and/or modify
+    it under the terms of the GNU General Public License as published by
+    the Free Software Foundation, either version 3 of the License, or
+    (at your option) any later version.
+
+    This program is distributed in the hope that it will be useful,
+    but WITHOUT ANY WARRANTY; without even the implied warranty of
+    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+    GNU General Public License for more details.
+
+    You should have received a copy of the GNU General Public License
+    along with this program.  If not, see <https://www.gnu.org/licenses/>.
+
+Also add information on how to contact you by electronic and paper mail.
+
+  If the program does terminal interaction, make it output a short
+notice like this when it starts in an interactive mode:
+
+    <program>  Copyright (C) <year>  <name of author>
+    This program comes with ABSOLUTELY NO WARRANTY; for details type `show w'.
+    This is free software, and you are welcome to redistribute it
+    under certain conditions; type `show c' for details.
+
+The hypothetical commands `show w' and `show c' should show the appropriate
+parts of the General Public License.  Of course, your program's commands
+might be different; for a GUI interface, you would use an "about box".
+
+  You should also get your employer (if you work as a programmer) or school,
+if any, to sign a "copyright disclaimer" for the program, if necessary.
+For more information on this, and how to apply and follow the GNU GPL, see
+<https://www.gnu.org/licenses/>.
+
+  The GNU General Public License does not permit incorporating your program
+into proprietary programs.  If your program is a subroutine library, you
+may consider it more useful to permit linking proprietary applications with
+the library.  If this is what you want to do, use the GNU Lesser General
+Public License instead of this License.  But first, please read
+<https://www.gnu.org/licenses/why-not-lgpl.html>.

README.md

@@ -1,3 +1,38 @@
-# FASTA-MLST
+# autoBIGS.engine
 
-A CLI tool for rapidly performing MLST typing via accessing pubMLST and InstitutPasteur MSLT databases.
+A python library implementing common BIGSdb MLST schemes and databases accesses for the purpose of typing sequences automatically. Implementation follows the RESTful API outlined by the official [BIGSdb documentation](https://bigsdb.readthedocs.io/en/latest/rest.html) up to `V1.50.0`.
+
+
+## Features
+
+Briefly, this library can:
+- Import multiple `FASTA` files
+- Fetch the available BIGSdb databases that is currently live and available
+- Fetch the available BIGSdb database schemes for a given MLST database
+- Retrieve exact/non-exact MLST allele variant IDs based off a sequence
+- Retrieve MLST sequence type IDs based off a sequence
+- Output all results to a single CSV
+
+Furthermore, this library is highly asynchronous where any potentially blocking operation, ranging from parsing FASTAs to performing HTTP requests are at least asynchronous, if not fully multithreaded.
+
+## Usage
+
+This library can be installed through pip. Learn how to [setup and install pip first](https://pip.pypa.io/en/stable/installation/).
+
+Then, it's as easy as running `pip install autobigs-engine` in any terminal that has pip in it's path (any terminal where `pip --version` returns a valid version and install path).
+
+### CLI usage
+
+This is a independent python library and thus does not have any form of direct user interface. One way of using it could be to create your own Python script that makes calls to this libraries functions. Alternatively, you may use `autobigs-cli`, a `Python` package that implements a CLI for calling this library.
+
+## Versioning
+
+the autoBIGS project follows [semantic versioning](https://semver.org/) where the three numbers may be interpreted as MAJOR.MINOR.PATCH.
+
+Note regarding major version 0 ([spec item 4](https://semver.org/#spec-item-4)), the following adaptation of semantic versioning definition is as follows:
+
+1. Given x.Y.z, Y is only incremented when a backwards incompatible change is made.
+
+2. Given x.y.Z, Z is only incremented when a backwards compatible change is made.
+
+Versions of autoBIGS items with a major version number of 0 will introduce numerous changes and patches. As such, changes between such versions should be considered highly variable.

environment.yml

@@ -0,0 +1,16 @@
+name: ci
+channels:
+  - bioconda
+  - conda-forge
+dependencies:
+  - aiohttp==3.11.*
+  - biopython==1.85
+  - pytest
+  - pytest-asyncio
+  - python-build
+  - conda-build
+  - twine==6.0.1
+  - setuptools_scm
+  - pytest-cov
+  - grayskull
+  - curl

pyproject.toml

@@ -3,18 +3,22 @@ requires = ["setuptools>=64", "setuptools_scm>=8"]
 build-backend = "setuptools.build_meta"
 
 [project]
-name = "automlst"
+name = "autoBIGS.engine"
 dynamic = ["version"]
+readme = "README.md"
 
 dependencies = [
-    "biopython",
-    "aiohttp[speedups]",
+    "biopython==1.85",
+    "aiohttp[speedups]==3.11.*",
 ]
-requires-python = ">=3.11"
-description = "A tool to rapidly fetch fetch MLST profiles given sequences for various diseases."
+requires-python = ">=3.12"
+description = "A library to rapidly fetch fetch MLST profiles given sequences for various diseases."
+license = {text = "GPL-3.0-or-later"}
 
-[project.scripts]
-automlst = "automlst.cli.program:run"
+[project.urls]
+Homepage = "https://github.com/Syph-and-VPD-Lab/autoBIGS.engine"
+Source = "https://github.com/Syph-and-VPD-Lab/autoBIGS.engine"
+Issues = "https://github.com/Syph-and-VPD-Lab/autoBIGS.engine/issues"
 
 [tool.setuptools_scm]
 

requirements.txt

@@ -1,7 +0,0 @@
-aiohttp[speedups]
-biopython
-pytest
-pytest-asyncio
-build
-twine
-setuptools_scm

scripts/patch_recipe.py

@@ -0,0 +1,103 @@
+#!/usr/bin/env python3
+
+import argparse
+from os import fdopen, path
+import os
+import re
+import shutil
+from sys import argv
+import tempfile
+
+INDENTATION = "  "
+GRAYSKULL_OUTPUT_PATH = "autoBIGS.engine"
+RUN_EXPORTED_VALUE = r'{{ pin_subpackage( name|lower|replace(".", "-"), max_pin="x.x") }}'
+LICENSE_SUFFIX = "-or-later"
+HOME_PAGE = "https://github.com/Syph-and-VPD-Lab/autoBIGS.engine"
+
+def _calc_indentation(line: str):
+    return len(re.findall(INDENTATION, line.split(line.strip())[0])) if line != "\n" else 0
+
+def read_grayskull_output():
+    original_recipe = path.abspath(GRAYSKULL_OUTPUT_PATH)
+    original_meta = path.join(original_recipe, "meta.yaml")
+    meta_file = open(original_meta)
+    lines = meta_file.readlines()
+    meta_file.close()
+    return lines
+
+def update_naming_scheme(lines):
+    modified_lines = []
+    for line in lines:
+        matches = re.finditer(r"\{\{\s*name\|lower()\s+\}\}", line)
+        modified_line = line
+        for match in matches:
+            modified_line = modified_line[:match.start(1)] + r'|replace(".", "-")' + modified_line[match.end(1):]
+        modified_lines.append(modified_line)
+    return modified_lines
+
+def inject_run_exports(lines: list[str]):
+    package_indent = False
+    modified_lines = []
+    for line in lines:
+        indentation_count = _calc_indentation(line)
+        if line == "build:\n" and indentation_count == 0:
+            package_indent = True
+            modified_lines.append(line)
+        elif package_indent and indentation_count == 0:
+            modified_lines.append(INDENTATION*1 + "run_exports:\n")
+            modified_lines.append(INDENTATION*2 + "- " + RUN_EXPORTED_VALUE + "\n")
+            package_indent = False
+        else:
+            modified_lines.append(line)
+    return modified_lines
+
+def suffix_license(lines: list[str]):
+    about_indent = False
+    modified_lines = []
+    for line in lines:
+        indentation_count = _calc_indentation(line)
+        if line == "about:\n" and indentation_count == 0:
+            about_indent = True
+            modified_lines.append(line)
+        elif about_indent and indentation_count == 1 and line.lstrip().startswith("license:"):
+            modified_lines.append(line.rstrip() + LICENSE_SUFFIX  + "\n")
+            about_indent = False
+        else:
+            modified_lines.append(line)
+    return modified_lines
+
+def inject_home_page(lines: list[str]):
+    about_indent = False
+    modified_lines = []
+    for line in lines:
+        indentation_count = _calc_indentation(line)
+        if line == "about:\n" and indentation_count == 0:
+            about_indent = True
+            modified_lines.append(line)
+        elif about_indent and indentation_count == 0:
+            modified_lines.append(INDENTATION + "home: " + HOME_PAGE + "\n")
+            about_indent = False
+        else:
+            modified_lines.append(line)
+    return modified_lines
+
+def write_to_original(lines: list[str]):
+    original_recipe = path.abspath(GRAYSKULL_OUTPUT_PATH)
+    original_meta = path.join(original_recipe, "meta.yaml")
+    with open(original_meta, "w") as file:
+        file.writelines(lines)
+
+def rename_recipe_dir():
+    new_recipe_name = path.abspath(path.join(GRAYSKULL_OUTPUT_PATH.replace(".", "-").lower()))
+    shutil.rmtree(new_recipe_name, ignore_errors=True)
+    os.replace(path.abspath(GRAYSKULL_OUTPUT_PATH), new_recipe_name)
+
+if __name__ == "__main__":
+    original_grayskull_out = read_grayskull_output()
+    modified_recipe_meta = None
+    modified_recipe_meta = update_naming_scheme(original_grayskull_out)
+    modified_recipe_meta = inject_run_exports(modified_recipe_meta)
+    modified_recipe_meta = suffix_license(modified_recipe_meta)
+    modified_recipe_meta = inject_home_page(modified_recipe_meta)
+    write_to_original(modified_recipe_meta)
+    rename_recipe_dir()

src/autobigs/engine/analysis/bigsdb.py

@@ -0,0 +1,274 @@
+from abc import abstractmethod
+import asyncio
+from collections import defaultdict
+from contextlib import AbstractAsyncContextManager
+import csv
+from os import path
+import os
+import shutil
+import tempfile
+from typing import Any, AsyncGenerator, AsyncIterable, Coroutine, Iterable, Mapping, Sequence, Set, Union
+
+from aiohttp import ClientOSError, ClientSession, ClientTimeout, ServerDisconnectedError
+
+from autobigs.engine.reading import read_fasta
+from autobigs.engine.structures.alignment import PairwiseAlignment
+from autobigs.engine.structures.genomics import NamedString
+from autobigs.engine.structures.mlst import Allele, NamedMLSTProfile, AlignmentStats, MLSTProfile
+from autobigs.engine.exceptions.database import NoBIGSdbExactMatchesException, NoBIGSdbMatchesException, NoSuchBIGSdbDatabaseException
+
+from Bio.Align import PairwiseAligner
+
+class BIGSdbMLSTProfiler(AbstractAsyncContextManager):
+
+    @abstractmethod
+    def determine_mlst_allele_variants(self, query_sequence_strings: Union[Iterable[Union[NamedString, str]], Union[NamedString, str]]) -> AsyncGenerator[Union[Allele, tuple[str, Allele]], Any]:
+        pass
+
+    @abstractmethod
+    async def determine_mlst_st(self, alleles: Union[AsyncIterable[Union[Allele, tuple[str, Allele]]], Iterable[Union[Allele, tuple[str, Allele]]]]) -> Union[MLSTProfile, NamedMLSTProfile]:
+        pass
+
+    @abstractmethod
+    async def profile_string(self, query_sequence_strings: Iterable[Union[NamedString, str]]) -> Union[NamedMLSTProfile, MLSTProfile]:
+        pass
+
+    @abstractmethod
+    def profile_multiple_strings(self, query_named_string_groups: AsyncIterable[Iterable[NamedString]], stop_on_fail: bool = False) -> AsyncGenerator[NamedMLSTProfile, Any]:
+        pass
+
+    @abstractmethod
+    async def close(self):
+        pass
+
+class RemoteBIGSdbMLSTProfiler(BIGSdbMLSTProfiler):
+
+    def __init__(self, database_api: str, database_name: str, scheme_id: int, retry_requests: int = 5):
+        self._retry_limit = retry_requests
+        self._database_name = database_name
+        self._scheme_id = scheme_id
+        self._base_url = f"{database_api}/db/{self._database_name}/schemes/{self._scheme_id}/"
+        self._http_client = ClientSession(self._base_url, timeout=ClientTimeout(300))
+
+    async def __aenter__(self):
+        return self
+
+    async def determine_mlst_allele_variants(self, query_sequence_strings: Union[Iterable[Union[NamedString, str]], Union[NamedString, str]]) -> AsyncGenerator[Union[Allele, tuple[str, Allele]], Any]:
+        # See https://bigsdb.pasteur.fr/api/db/pubmlst_bordetella_seqdef/schemes
+        uri_path = "sequence"
+        if isinstance(query_sequence_strings, str) or isinstance(query_sequence_strings, NamedString):
+            query_sequence_strings = [query_sequence_strings]
+        
+        for sequence_string in query_sequence_strings:
+            attempts = 0
+            success = False
+            last_error = None
+            while not success and attempts < self._retry_limit:
+                attempts += 1
+                request = self._http_client.post(uri_path, json={
+                    "sequence": sequence_string if isinstance(sequence_string, str) else sequence_string.sequence,
+                    "partial_matches": True
+                })
+                try:
+                    async with request as response:
+                        sequence_response: dict = await response.json()
+
+                        if "exact_matches" in sequence_response:
+                            # loci -> list of alleles with id and loci
+                            exact_matches: dict[str, Sequence[dict[str, str]]] = sequence_response["exact_matches"]  
+                            for allele_loci, alleles in exact_matches.items():
+                                for allele in alleles:
+                                    alelle_id = allele["allele_id"]
+                                    result_allele = Allele(allele_locus=allele_loci, allele_variant=alelle_id, partial_match_profile=None)
+                                    yield result_allele if isinstance(sequence_string, str) else (sequence_string.name, result_allele)
+                        elif "partial_matches" in sequence_response:
+                            partial_matches: dict[str, dict[str, Union[str, float, int]]] = sequence_response["partial_matches"] 
+                            for allele_loci, partial_match in partial_matches.items():
+                                if len(partial_match) <= 0:
+                                    continue
+                                partial_match_profile = AlignmentStats(
+                                    percent_identity=float(partial_match["identity"]),
+                                    mismatches=int(partial_match["mismatches"]),
+                                    gaps=int(partial_match["gaps"]),
+                                    match_metric=int(partial_match["bitscore"])
+                                )
+                                result_allele = Allele(
+                                    allele_locus=allele_loci,
+                                    allele_variant=str(partial_match["allele"]),
+                                    partial_match_profile=partial_match_profile
+                                )
+                                yield result_allele if isinstance(sequence_string, str) else (sequence_string.name, result_allele)
+                        else:
+                            raise NoBIGSdbMatchesException(self._database_name, self._scheme_id, sequence_string.name if isinstance(sequence_string, NamedString) else None)
+                except (ConnectionError, ServerDisconnectedError, ClientOSError) as e: # Errors we will retry
+                    last_error = e
+                    success = False
+                    await asyncio.sleep(5) # In case the connection issue is due to rate issues
+                else:
+                    success = True
+            if not success and last_error is not None:
+                try:
+                    raise last_error
+                except (ConnectionError, ServerDisconnectedError, ClientOSError) as e: # Non-fatal errors
+                    yield Allele("error", "error", None)
+
+    async def determine_mlst_st(self, alleles: Union[AsyncIterable[Union[Allele, tuple[str, Allele]]], Iterable[Union[Allele, tuple[str, Allele]]]]) -> Union[MLSTProfile, NamedMLSTProfile]:
+        uri_path = "designations"
+        allele_request_dict: dict[str, list[dict[str, str]]] = defaultdict(list)
+        names_list = []
+        def insert_allele_to_request_dict(allele: Union[Allele, tuple[str, Allele]]):
+            if isinstance(allele, Allele):
+                allele_val = allele
+            else:
+                allele_val = allele[1]
+                names_list.append(allele[0])
+            allele_request_dict[allele_val.allele_locus].append({"allele": str(allele_val.allele_variant)})
+
+        if isinstance(alleles, AsyncIterable):
+            async for allele in alleles:
+                insert_allele_to_request_dict(allele)
+        else:
+            for allele in alleles:
+                insert_allele_to_request_dict(allele)
+        request_json = {
+            "designations": allele_request_dict
+        }
+
+        attempts = 0
+        success = False
+        last_error = None
+        while attempts < self._retry_limit and not success:
+            attempts += 1
+            try:
+                async with self._http_client.post(uri_path, json=request_json) as response:
+                    response_json: dict = await response.json()
+                    allele_set: Set[Allele] = set()
+                    response_json.setdefault("fields", dict())
+                    scheme_fields_returned: dict[str, str] = response_json["fields"]
+                    scheme_fields_returned.setdefault("ST", "unknown")
+                    scheme_fields_returned.setdefault("clonal_complex", "unknown")
+                    scheme_exact_matches: dict = response_json["exact_matches"]
+                    for exact_match_locus, exact_match_alleles in scheme_exact_matches.items():
+                        allele_set.add(Allele(exact_match_locus, exact_match_alleles[0]["allele_id"], None))
+                    if len(allele_set) == 0:
+                        raise ValueError("Passed in no alleles.")
+                    result_mlst_profile = MLSTProfile(allele_set, scheme_fields_returned["ST"], scheme_fields_returned["clonal_complex"])
+                    if len(names_list) > 0:
+                        result_mlst_profile = NamedMLSTProfile(str(tuple(names_list)) if len(set(names_list)) > 1 else names_list[0], result_mlst_profile)
+                    return result_mlst_profile
+            except (ConnectionError, ServerDisconnectedError, ClientOSError) as e:
+                last_error = e
+                success = False
+                await asyncio.sleep(5)
+            else:
+                success = True
+        try:
+            if last_error is not None:
+                raise last_error
+        except (ConnectionError, ServerDisconnectedError, ClientOSError) as e:
+                result_mlst_profile = NamedMLSTProfile((str(tuple(names_list)) if len(set(names_list)) > 1 else names_list[0]) + ":Error", None)
+        raise ValueError("Last error was not recorded.")
+
+                    
+    async def profile_string(self, query_sequence_strings: Iterable[Union[NamedString, str]]) -> Union[NamedMLSTProfile, MLSTProfile]:
+        alleles = self.determine_mlst_allele_variants(query_sequence_strings)
+        return await self.determine_mlst_st(alleles)
+
+    async def profile_multiple_strings(self, query_named_string_groups: AsyncIterable[Iterable[NamedString]], stop_on_fail: bool = False) -> AsyncGenerator[NamedMLSTProfile, Any]:
+        tasks: list[Coroutine[Any, Any, Union[NamedMLSTProfile, MLSTProfile]]] = []
+        async for named_strings in query_named_string_groups:
+            tasks.append(self.profile_string(named_strings))
+        for task in asyncio.as_completed(tasks):
+            named_mlst_profile = await task
+            try:
+                if isinstance(named_mlst_profile, NamedMLSTProfile):
+                    yield named_mlst_profile
+                else:
+                    raise TypeError("MLST profile is not named.")
+            except NoBIGSdbMatchesException as e:
+                if stop_on_fail:
+                    raise e
+                causal_name = e.get_causal_query_name()
+                if causal_name is None:
+                    raise ValueError("Missing query name despite requiring names.")
+                else:
+                    yield NamedMLSTProfile(causal_name, None)
+
+    async def close(self):
+        await self._http_client.close()
+
+    async def __aexit__(self, exc_type, exc_value, traceback):
+        await self.close()
+
+class BIGSdbIndex(AbstractAsyncContextManager):
+    KNOWN_BIGSDB_APIS = {
+        "https://bigsdb.pasteur.fr/api",
+        "https://rest.pubmlst.org"
+    }
+
+    def __init__(self):
+        self._http_client = ClientSession()
+        self._known_seqdef_dbs_origin: Union[Mapping[str, str], None] = None
+        self._seqdefdb_schemes: dict[str, Union[Mapping[str, int], None]] = dict()
+        super().__init__()
+
+    async def __aenter__(self):
+        return self
+    
+    async def get_known_seqdef_dbs(self, force: bool = False) -> Mapping[str, str]:
+        if self._known_seqdef_dbs_origin is not None and not force:
+            return self._known_seqdef_dbs_origin
+        known_seqdef_dbs = dict()
+        for known_bigsdb in BIGSdbIndex.KNOWN_BIGSDB_APIS:
+            async with self._http_client.get(f"{known_bigsdb}/db") as response:
+                response_json_databases = await response.json()
+                for database_group in response_json_databases:
+                    for database_info in database_group["databases"]:
+                        if str(database_info["name"]).endswith("seqdef"):
+                            known_seqdef_dbs[database_info["name"]] = known_bigsdb
+        self._known_seqdef_dbs_origin = dict(known_seqdef_dbs)
+        return self._known_seqdef_dbs_origin
+
+    async def get_bigsdb_api_from_seqdefdb(self, seqdef_db_name: str) -> str:
+        known_databases = await self.get_known_seqdef_dbs()
+        if seqdef_db_name not in known_databases:
+            raise NoSuchBIGSdbDatabaseException(seqdef_db_name)
+        return known_databases[seqdef_db_name]     
+
+    async def get_schemes_for_seqdefdb(self, seqdef_db_name: str, force: bool = False) -> Mapping[str, int]:
+        if seqdef_db_name in self._seqdefdb_schemes and not force:
+            return self._seqdefdb_schemes[seqdef_db_name] # type: ignore since it's guaranteed to not be none by conditional
+        uri_path = f"{await self.get_bigsdb_api_from_seqdefdb(seqdef_db_name)}/db/{seqdef_db_name}/schemes"
+        async with self._http_client.get(uri_path) as response: 
+            response_json = await response.json()
+            scheme_descriptions: Mapping[str, int] = dict()
+            for scheme_definition in response_json["schemes"]:
+                scheme_id: int = int(str(scheme_definition["scheme"]).split("/")[-1])
+                scheme_desc: str = scheme_definition["description"]
+                scheme_descriptions[scheme_desc] = scheme_id
+            self._seqdefdb_schemes[seqdef_db_name] = scheme_descriptions
+            return self._seqdefdb_schemes[seqdef_db_name] # type: ignore
+
+    async def build_profiler_from_seqdefdb(self, local: bool, dbseqdef_name: str, scheme_id: int) -> BIGSdbMLSTProfiler:
+        return get_BIGSdb_MLST_profiler(local, await self.get_bigsdb_api_from_seqdefdb(dbseqdef_name), dbseqdef_name, scheme_id)
+    
+    async def get_scheme_loci(self, dbseqdef_name: str, scheme_id: int) -> list[str]:
+        uri_path = f"{await self.get_bigsdb_api_from_seqdefdb(dbseqdef_name)}/db/{dbseqdef_name}/schemes/{scheme_id}"
+        async with self._http_client.get(uri_path) as response:
+            response_json = await response.json()
+            loci = response_json["loci"]
+            results = []
+            for locus in loci:
+                results.append(path.basename(locus))
+            return results
+
+    async def close(self):
+        await self._http_client.close()
+
+    async def __aexit__(self, exc_type, exc_value, traceback):
+        await self.close()
+
+def get_BIGSdb_MLST_profiler(local: bool, database_api: str, database_name: str, scheme_id: int):
+    if local:
+        raise NotImplementedError()
+    return RemoteBIGSdbMLSTProfiler(database_api=database_api, database_name=database_name, scheme_id=scheme_id)

src/autobigs/engine/exceptions/database.py

@@ -0,0 +1,25 @@
+from typing import Union
+
+class BIGSDbDatabaseAPIException(Exception):
+    pass
+
+
+class NoBIGSdbMatchesException(BIGSDbDatabaseAPIException):
+    def __init__(self, database_name: str, database_scheme_id: int, query_name: Union[None, str], *args):
+        self._query_name = query_name
+        super().__init__(f"No matches found with scheme with ID {database_scheme_id}  in the database \"{database_name}\".", *args)
+    
+    def get_causal_query_name(self) -> Union[str, None]:
+        return self._query_name
+
+class NoBIGSdbExactMatchesException(NoBIGSdbMatchesException):
+    def __init__(self, database_name: str, database_scheme_id: int, *args):
+        super().__init__(f"No exact match found with scheme with ID {database_scheme_id}  in the database \"{database_name}\".", *args)
+
+class NoSuchBIGSdbDatabaseException(BIGSDbDatabaseAPIException):
+    def __init__(self, database_name: str, *args):
+        super().__init__(f"No database \"{database_name}\" found.", *args)
+
+class NoSuchBigSdbschemeException(BIGSDbDatabaseAPIException):
+    def __init__(self, database_name: str, database_scheme_id: int, *args):
+        super().__init__(f"No scheme with ID {database_scheme_id}  in \"{database_name}\" found.", *args)

src/autobigs/engine/reading.py

@@ -0,0 +1,21 @@
+import asyncio
+from io import TextIOWrapper
+from os import path
+from typing import Any, AsyncGenerator, Iterable, Union
+from Bio import SeqIO
+
+from autobigs.engine.structures.genomics import NamedString
+
+async def read_fasta(handle: Union[str, TextIOWrapper]) -> Iterable[NamedString]:
+    fasta_sequences = asyncio.to_thread(SeqIO.parse, handle=handle, format="fasta")
+    results = []
+    for fasta_sequence in await fasta_sequences:
+        results.append(NamedString("{0}:{1}".format(path.basename(handle.name if isinstance(handle, TextIOWrapper) else handle), fasta_sequence.id), str(fasta_sequence.seq)))
+    return results
+
+async def read_multiple_fastas(handles: Iterable[Union[str, TextIOWrapper]]) -> AsyncGenerator[Iterable[NamedString], Any]:
+    tasks = []
+    for handle in handles:
+        tasks.append(read_fasta(handle))
+    for task in asyncio.as_completed(tasks):
+        yield await task

src/autobigs/engine/structures/alignment.py

@@ -0,0 +1,18 @@
+from dataclasses import dataclass
+from numbers import Number
+from typing import Sequence
+
+@dataclass(frozen=True)
+class AlignmentStats:
+    percent_identity: float
+    mismatches: int
+    gaps: int
+    match_metric: int
+
+@dataclass(frozen=True)
+class PairwiseAlignment:
+    reference: str
+    query: str
+    reference_indices: Sequence[Number]
+    query_indices: Sequence[Number]
+    alignment_stats: AlignmentStats

src/autobigs/engine/structures/genomics.py

@@ -25,7 +25,7 @@ class SangerTraceData(NamedString):
     analysis_proto_settings_name: str
     analysis_rpto_settings_ver: str
     analysis_proto_xml_data: str
-    analysis_proto_xml_schema_ver: str
+    analysis_proto_xml_scheme_ver: str
     sample_comment: Union[None, str]
     capillary_machine: bool
     container_identifier: str

src/autobigs/engine/structures/mlst.py

@@ -0,0 +1,33 @@
+from collections import defaultdict
+from dataclasses import dataclass
+from typing import Collection, Iterable, Mapping, Sequence, Union
+
+from autobigs.engine.structures.alignment import AlignmentStats
+
+@dataclass(frozen=True)
+class Allele:
+    allele_locus: str
+    allele_variant: str
+    partial_match_profile: Union[None, AlignmentStats]
+
+@dataclass(frozen=True)
+class MLSTProfile:
+    alleles: Collection[Allele]
+    sequence_type: str
+    clonal_complex: str
+
+@dataclass(frozen=True)
+class NamedMLSTProfile:
+    name: str
+    mlst_profile: Union[None, MLSTProfile]
+
+
+def alleles_to_mapping(alleles: Iterable[Allele]):
+    result = defaultdict(list)
+    for allele in alleles:
+        result[allele.allele_locus].append(allele.allele_variant)
+    result = dict(result)
+    for locus, variant in result.items():
+        if len(variant) == 1:
+            result[locus] = variant[0]
+    return result

src/autobigs/engine/writing.py

@@ -0,0 +1,43 @@
+from collections import defaultdict
+import csv
+from os import PathLike
+from typing import AsyncIterable, Collection, Iterable, Mapping, Sequence, Union
+
+from autobigs.engine.structures.mlst import Allele, MLSTProfile, NamedMLSTProfile
+
+
+def alleles_to_text_map(alleles: Collection[Allele]) -> Mapping[str, Union[Sequence[str], str]]:
+    result = defaultdict(list)
+    for allele in alleles:
+        result[allele.allele_locus].append(allele.allele_variant + ("*" if allele.partial_match_profile is not None else ""))
+    for locus in result.keys():
+        if len(result[locus]) == 1:
+            result[locus] = result[locus][0] # Take the only one
+        else:
+            result[locus] = tuple(result[locus]) # type: ignore
+    return dict(result)
+
+async def write_mlst_profiles_as_csv(mlst_profiles_iterable: AsyncIterable[NamedMLSTProfile], handle: Union[str, bytes, PathLike[str], PathLike[bytes]], allele_names: Iterable[str]) -> Sequence[str]:
+    failed = list()
+    with open(handle, "w", newline='') as filehandle:
+        header = None
+        writer: Union[csv.DictWriter, None] = None
+        async for named_mlst_profile in mlst_profiles_iterable:
+            name = named_mlst_profile.name
+            mlst_profile = named_mlst_profile.mlst_profile
+            if mlst_profile is None:
+                failed.append(name)
+                continue
+            allele_mapping = alleles_to_text_map(mlst_profile.alleles)
+            if writer is None:
+                header = ["id", "st", "clonal-complex", *sorted(allele_names)]
+                writer = csv.DictWriter(filehandle, fieldnames=header)
+                writer.writeheader()
+            row_dictionary = {
+                "st": mlst_profile.sequence_type,
+                "clonal-complex": mlst_profile.clonal_complex,
+                "id": name,
+                **allele_mapping
+            }
+            writer.writerow(rowdict=row_dictionary)
+    return failed

src/automlst/cli/exactmatch.py

@@ -1,48 +0,0 @@
-
-from argparse import ArgumentParser
-import asyncio
-import datetime
-from automlst.engine.local.csv import write_mlst_profiles_as_csv
-from automlst.engine.local.fasta import read_multiple_fastas
-from automlst.engine.remote.databases.bigsdb import BIGSdbIndex
-
-
-def setup_parser(parser: ArgumentParser):
-    parser.description = "Returns MLST exact profile matches."
-    parser.add_argument(
-        "fastas",
-        nargs="+",
-        action='extend',
-        default=[],
-        type=str,
-        help="The FASTA files to process. Multiple can be listed."
-    )
-
-    parser.add_argument(
-        "seqdefdb",
-        help="The BIGSdb seqdef database to use for typing."
-    )
-
-    parser.add_argument(
-        "schema",
-        type=int,
-        help="The BIGSdb seqdef database schema ID (integer) to use for typing."
-    )
-
-    parser.add_argument(
-        "out",
-        default=f'./{datetime.datetime.now().strftime(r"%Y%m%d%H%M%S")}',
-        help="The output CSV name (.csv will be appended)."
-    )
-    parser.set_defaults(func=run_asynchronously)
-
-async def run(args):
-    async with BIGSdbIndex() as bigsdb_index:
-        gen_strings = read_multiple_fastas(args.fastas)
-        async with await bigsdb_index.build_profiler_from_seqdefdb(args.seqdefdb, args.schema) as mlst_profiler:
-            mlst_profiles = mlst_profiler.profile_multiple_strings(gen_strings)
-            await write_mlst_profiles_as_csv(mlst_profiles, args.out)
-
-def run_asynchronously(args):
-    asyncio.run(run(args))
-

src/automlst/cli/info.py

@@ -1,44 +0,0 @@
-from argparse import ArgumentParser
-import asyncio
-from automlst.engine.remote.databases.bigsdb import BIGSdbIndex
-
-
-def setup_parser(parser: ArgumentParser):
-    parser.description = "Fetches the latest BIGSdb MLST database definitions."
-    parser.usage = "test"
-    parser.add_argument(
-        "--retrieve-bigsdbs", "-l",
-        action="store_true",
-        dest="list_dbs",
-        required=False,
-        default=False,
-        help="Lists all known BIGSdb MLST databases (fetched from known APIs and cached)."
-    )
-
-    parser.add_argument(
-        "--retrieve-bigsdb-schemas", "-lschemas",
-        nargs="+",
-        action="extend",
-        dest="list_bigsdb_schemas",
-        required=False,
-        default=[],
-        type=str,
-        help="Lists the known schema IDs for a given BIGSdb sequence definition database name. The name, and then the ID of the schema is given."
-    )
-
-    parser.set_defaults(func=run_asynchronously)
-
-async def run(args):
-    async with BIGSdbIndex() as bigsdb_index:
-        if args.list_dbs:
-            known_seqdef_dbs = await bigsdb_index.get_known_seqdef_dbs(force=False)
-            print("\n".join(known_seqdef_dbs.keys()))
-
-        for bigsdb_schema_name in args.list_bigsdb_schemas:
-            schemas = await bigsdb_index.get_schemas_for_seqdefdb(bigsdb_schema_name)
-            for schema_desc, schema_id in schemas.items():
-                print(f"{schema_desc}: {schema_id}")
-
-def run_asynchronously(args):
-    asyncio.run(run(args))
-

src/automlst/cli/meta.py

@@ -1,2 +0,0 @@
-def get_module_base_name(name):
-    return name.split(".")[-1]

src/automlst/cli/program.py

@@ -1,27 +0,0 @@
-import argparse
-import asyncio
-import datetime
-from os import path
-import os
-
-from automlst.cli import exactmatch, info
-from automlst.cli.meta import get_module_base_name
-from automlst.engine.data.genomics import NamedString
-from automlst.engine.local.abif import read_abif
-from automlst.engine.local.csv import write_mlst_profiles_as_csv
-from automlst.engine.local.fasta import read_fasta
-from automlst.engine.remote.databases.bigsdb import BIGSdbIndex
-
-root_parser = argparse.ArgumentParser()
-subparsers = root_parser.add_subparsers(required=True)
-
-info.setup_parser(subparsers.add_parser(get_module_base_name(info.__name__)))
-exactmatch.setup_parser(subparsers.add_parser(get_module_base_name(exactmatch.__name__)))
-
-
-def run():
-    args = root_parser.parse_args()
-    args.func(args)
-
-if __name__ == "__main__":
-    run()

src/automlst/engine/data/mlst.py

@@ -1,13 +0,0 @@
-from dataclasses import dataclass
-from typing import Mapping, Sequence
-
-@dataclass(frozen=True)
-class Allele:
-    allele_loci: str
-    allele_variant: str
-
-@dataclass(frozen=True)
-class MLSTProfile:
-    alleles: Mapping[str, Sequence[Allele]]
-    sequence_type: int
-    clonal_complex: str

src/automlst/engine/local/abif.py

@@ -1,126 +0,0 @@
-import asyncio
-from numbers import Number
-from os import path
-from typing import Any, AsyncGenerator, Collection, Iterable, Sequence, Union
-from automlst.engine.data.genomics import NamedString, SangerTraceData
-from Bio.SeqRecord import SeqRecord
-from Bio import SeqIO, Align
-
-from automlst.engine.remote.databases.ncbi.genbank import fetch_ncbi_genbank
-
-
-def _biopython_read_abif_sequence(seq_path: str) -> SeqRecord:
-    with open(seq_path, "rb") as seq_handle:
-        return SeqIO.read(seq_handle, "abi")
-
-
-async def read_abif(seq_path: str) -> SangerTraceData:
-    ext = path.splitext(seq_path)[1]
-    if ext.lower() != ".ab1" and ext.lower() != "abi":
-        raise ValueError(
-            'seq_path must have file extension of "ab1", or "abi".')
-    biopython_seq = await asyncio.to_thread(_biopython_read_abif_sequence, seq_path)
-    biopython_annotations = biopython_seq.annotations
-
-    # Lot of type ignoring since Biopython did not define their typing.
-    biopython_abif_raw = biopython_annotations["abif_raw"]  # type: ignore
-    trace_data = SangerTraceData(
-        path.basename(seq_path),
-        biopython_seq.seq,
-        biopython_abif_raw.get("APFN2"),  # type: ignore
-        biopython_abif_raw.get("APrN1"),  # type: ignore
-        biopython_abif_raw.get("APrV1"),  # type: ignore
-        biopython_abif_raw.get("APrX1"),  # type: ignore
-        biopython_abif_raw.get("APXV1"),  # type: ignore
-        biopython_abif_raw.get("CMNT1"),  # type: ignore
-        biopython_abif_raw.get("CpEP1"),  # type: ignore
-        biopython_abif_raw.get("CTID1"),  # type: ignore
-        biopython_abif_raw.get("CTNM1"),  # type: ignore
-        biopython_abif_raw.get("CTTL1"),  # type: ignore
-        biopython_abif_raw.get("DATA1"),  # type: ignore
-        biopython_abif_raw.get("DATA2"),  # type: ignore
-        biopython_abif_raw.get("DATA3"),  # type: ignore
-        biopython_abif_raw.get("DATA4"),  # type: ignore
-        biopython_abif_raw.get("DATA5"),  # type: ignore
-        biopython_abif_raw.get("DATA6"),  # type: ignore
-        biopython_abif_raw.get("DATA7"),  # type: ignore
-        biopython_abif_raw.get("DATA8"),  # type: ignore
-        biopython_abif_raw.get("DSam1"),  # type: ignore
-        biopython_abif_raw.get("DyeN1"),  # type: ignore
-        biopython_abif_raw.get("DyeN2"),  # type: ignore
-        biopython_abif_raw.get("DyeN3"),  # type: ignore
-        biopython_abif_raw.get("DyeN4"),  # type: ignore
-        biopython_abif_raw.get("DyeW1"),  # type: ignore
-        biopython_abif_raw.get("DyeW2"),  # type: ignore
-        biopython_abif_raw.get("DyeW3"),  # type: ignore
-        biopython_abif_raw.get("DyeW4"),  # type: ignore
-        biopython_abif_raw.get("DySN1"),  # type: ignore
-        biopython_abif_raw.get("EPVt1"),  # type: ignore
-        biopython_abif_raw.get("EVNT1"),  # type: ignore
-        biopython_abif_raw.get("EVNT2"),  # type: ignore
-        biopython_abif_raw.get("EVNT3"),  # type: ignore
-        biopython_abif_raw.get("EVNT4"),  # type: ignore
-        biopython_abif_raw.get("FWO_1"),  # type: ignore
-        biopython_abif_raw.get("GTyp1"),  # type: ignore
-        biopython_abif_raw.get("InSc1"),  # type: ignore
-        biopython_abif_raw.get("InVt1"),  # type: ignore
-        biopython_abif_raw.get("LANE1"),  # type: ignore
-        biopython_abif_raw.get("LIMS1"),  # type: ignore
-        biopython_abif_raw.get("LNTD1"),  # type: ignore
-        biopython_abif_raw.get("LsrP1"),  # type: ignore
-        biopython_abif_raw.get("MCHN1"),  # type: ignore
-        biopython_abif_raw.get("MODF1"),  # type: ignore
-        biopython_abif_raw.get("MODL1"),  # type: ignore
-        biopython_abif_raw.get("NAVG1"),  # type: ignore
-        biopython_abif_raw.get("NLNE1"),  # type: ignore
-        biopython_abif_raw.get("OfSc1"),  # type: ignore
-        biopython_abif_raw.get("PDMF1"),  # type: ignore
-        biopython_abif_raw.get("PXLB1"),  # type: ignore
-        biopython_abif_raw.get("RGCm1"),  # type: ignore
-        biopython_abif_raw.get("RGNm1"),  # type: ignore
-        biopython_abif_raw.get("RMdV1"),  # type: ignore
-        biopython_abif_raw.get("RMdX1"),  # type: ignore
-        biopython_abif_raw.get("RMXV1"),  # type: ignore
-        biopython_abif_raw.get("RPrN1"),  # type: ignore
-        biopython_abif_raw.get("RPrV1"),  # type: ignore
-        biopython_abif_raw.get("RUND1"),  # type: ignore
-        biopython_abif_raw.get("RUND2"),  # type: ignore
-        biopython_abif_raw.get("RUND3"),  # type: ignore
-        biopython_abif_raw.get("RUND4"),  # type: ignore
-        biopython_abif_raw.get("RunN1"),  # type: ignore
-        biopython_abif_raw.get("RUNT1"),  # type: ignore
-        biopython_abif_raw.get("RUNT2"),  # type: ignore
-        biopython_abif_raw.get("RUNT3"),  # type: ignore
-        biopython_abif_raw.get("RUNT4"),  # type: ignore
-        biopython_abif_raw.get("Satd"),  # type: ignore
-        biopython_abif_raw.get("Scal1"),  # type: ignore
-        biopython_abif_raw.get("SCAN1"),  # type: ignore
-        biopython_abif_raw.get("SMED1"),  # type: ignore
-        biopython_abif_raw.get("SMLt"),  # type: ignore
-        biopython_abif_raw.get("SMPL1"),  # type: ignore
-        biopython_abif_raw.get("SVER1"),  # type: ignore
-        biopython_abif_raw.get("SVER3"),  # type: ignore
-        biopython_abif_raw.get("Tmpr1"),  # type: ignore
-        biopython_abif_raw.get("TUBE"),  # type: ignore
-        biopython_abif_raw.get("User")  # type: ignore
-    )
-    return trace_data
-
-
-def _biopython_local_pairwise_alignment(reference: NamedString, query: NamedString) -> tuple[NamedString, NamedString]:
-    aligner = Align.PairwiseAligner(scoring="blastn")
-    aligner.mode = "local"
-    alignment_result = sorted(aligner.align(reference.sequence, query.sequence))[
-        0]  # take the best alignment
-    # TODO actually assemble the consensus sequence here
-    raise NotImplementedError("Pairwise alignment unto reference consensus assembly function not ready.")
-
-
-async def reference_consensus_assembly(reference: Union[NamedString, str], sanger_traces: Iterable[SangerTraceData]) -> AsyncGenerator[NamedString, Any]:
-    if isinstance(reference, str):
-        reference_seq = NamedString(name=reference, sequence=(await fetch_ncbi_genbank(reference)).sequence)
-    else:
-        reference_seq: NamedString  = reference
-    for sanger_trace in sanger_traces:
-        yield NamedString("NA", "NA")
-        raise NotImplementedError("Pairwise alignment unto reference consensus assembly function not ready.")

src/automlst/engine/local/csv.py

@@ -1,33 +0,0 @@
-import csv
-from io import TextIOWrapper
-from os import PathLike
-from typing import AsyncIterable, Iterable, Mapping, Sequence, Union
-
-from automlst.engine.data.mlst import Allele, MLSTProfile
-
-
-def dict_loci_alleles_variants_from_loci(alleles_map: Mapping[str, Sequence[Allele]]):
-    result_dict: dict[str, list[str]] = {}
-    for loci, alleles in alleles_map.items():
-        result_dict[loci] = list()
-        for allele in alleles:
-            result_dict[loci].append(allele.allele_variant)
-    return result_dict
-
-
-async def write_mlst_profiles_as_csv(mlst_profiles_iterable: AsyncIterable[tuple[str, MLSTProfile]], handle: Union[str, bytes, PathLike[str], PathLike[bytes]]):
-    with open(handle, "w", newline='') as filehandle:
-        header = None
-        writer: Union[csv.DictWriter, None] = None
-        async for name, mlst_profile in mlst_profiles_iterable:
-            if writer is None:
-                header = ["id", "st", "clonal-complex", *mlst_profile.alleles.keys()]
-                writer = csv.DictWriter(filehandle, fieldnames=header)
-                writer.writeheader()
-            row_dictionary = {
-                "st": mlst_profile.sequence_type,
-                "clonal-complex": mlst_profile.clonal_complex,
-                "id": name,
-                **dict_loci_alleles_variants_from_loci(mlst_profile.alleles)
-            }
-            writer.writerow(rowdict=row_dictionary)

src/automlst/engine/local/fasta.py

@@ -1,16 +0,0 @@
-import asyncio
-from io import TextIOWrapper
-from typing import Any, AsyncGenerator, Generator, Iterable, Sequence, Union
-from Bio import SeqIO
-
-from automlst.engine.data.genomics import NamedString
-
-async def read_fasta(handle: Union[str, TextIOWrapper]) -> AsyncGenerator[NamedString, Any]:
-    fasta_sequences = asyncio.to_thread(SeqIO.parse, handle=handle, format="fasta")
-    for fasta_sequence in await fasta_sequences:
-        yield NamedString(fasta_sequence.id, str(fasta_sequence.seq))
-
-async def read_multiple_fastas(handles: Iterable[Union[str, TextIOWrapper]]) -> AsyncGenerator[NamedString, Any]:
-    for handle in handles:
-        async for named_seq in read_fasta(handle):
-            yield named_seq

src/automlst/engine/remote/databases/bigsdb.py

@@ -1,135 +0,0 @@
-from collections import defaultdict
-from contextlib import AbstractAsyncContextManager
-from typing import Any, AsyncGenerator, AsyncIterable, Collection, Generator, Iterable, Mapping, Sequence, Union
-
-from aiohttp import ClientSession, ClientTimeout
-
-from automlst.engine.data.genomics import NamedString
-from automlst.engine.data.mlst import Allele, MLSTProfile
-
-class BigSDBMLSTProfiler(AbstractAsyncContextManager):
-
-    def __init__(self, database_api: str, database_name: str, schema_id: int):
-        self._database_name = database_name
-        self._schema_id = schema_id
-        self._base_url = f"{database_api}/db/{self._database_name}/schemes/{self._schema_id}/"
-        self._http_client = ClientSession(self._base_url, timeout=ClientTimeout(10000))
-
-    async def __aenter__(self):
-        return self
-
-    async def fetch_mlst_allele_variants(self, sequence_string: str) -> AsyncGenerator[Allele, Any]:
-        # See https://bigsdb.pasteur.fr/api/db/pubmlst_bordetella_seqdef/schemes
-        uri_path = "sequence"
-        response = await self._http_client.post(uri_path, json={
-            "sequence": sequence_string
-        })
-        sequence_response: dict = await response.json()
-        if "exact_matches" not in sequence_response:
-            # TODO throw exception for not finding matches.
-            pass
-
-        if "exact_matches" not in sequence_response:
-            raise ValueError(f"Unable to find exact matches in \"{self._database_name}\" under schema ID \"{self._schema_id}\".")
-        exact_matches: dict[str, Sequence[dict[str, str]]] = sequence_response["exact_matches"]  
-        for allele_loci, alleles in exact_matches.items():
-            for allele in alleles:
-                alelle_id = allele["allele_id"]
-                yield Allele(allele_loci=allele_loci, allele_variant=alelle_id)
-
-    async def fetch_mlst_st(self, alleles: AsyncIterable[Allele]) -> MLSTProfile:
-        uri_path = "designations"
-        allele_request_dict: dict[str, list[dict[str, str]]] = defaultdict(list)
-        async for allele in alleles:
-            allele_request_dict[allele.allele_loci].append({"allele": str(allele.allele_variant)})
-
-        request_json = {
-            "designations": allele_request_dict
-        }
-        async with self._http_client.post(uri_path, json=request_json) as response:
-            response_json = await response.json()
-            if "fields" not in response_json:
-                # TODO raise exception about invalid parameters or no exact parameterization found
-                pass
-            schema_fields_returned = response_json["fields"]
-            schema_exact_matches: dict = response_json["exact_matches"]
-            allele_map: dict[str, list[Allele]] = defaultdict(list)
-            for exact_match_loci, exact_match_alleles in schema_exact_matches.items():
-                for exact_match_allele in exact_match_alleles:
-                    allele_map[exact_match_loci].append(Allele(exact_match_loci, exact_match_allele["allele_id"]))
-            return MLSTProfile(allele_map, schema_fields_returned["ST"], schema_fields_returned["clonal_complex"])
-
-    async def profile_string(self, string: str) -> MLSTProfile:
-        alleles = self.fetch_mlst_allele_variants(string)
-        return await self.fetch_mlst_st(alleles)
-
-
-    async def profile_multiple_strings(self, namedStrings: AsyncIterable[NamedString]) -> AsyncGenerator[tuple[str, MLSTProfile], Any]:
-        async for named_string in namedStrings:
-            yield (named_string.name, await self.profile_string(named_string.sequence))
-
-
-    async def close(self):
-        await self._http_client.close()
-
-    async def __aexit__(self, exc_type, exc_value, traceback):
-        await self.close()
-
-class BIGSdbIndex(AbstractAsyncContextManager):
-    KNOWN_BIGSDB_APIS = {
-        "https://bigsdb.pasteur.fr/api",
-        "https://rest.pubmlst.org"
-    }
-
-    def __init__(self):
-        self._http_client = ClientSession()
-        self._known_seqdef_dbs_origin: Union[Mapping[str, str], None] = None
-        self._seqdefdb_schemas: dict[str, Union[Mapping[str, int], None]] = dict()
-        super().__init__()
-
-    async def __aenter__(self):
-        return self
-    
-    async def get_known_seqdef_dbs(self, force: bool = False) -> Mapping[str, str]:
-        if self._known_seqdef_dbs_origin is not None and not force:
-            return self._known_seqdef_dbs_origin
-        known_seqdef_dbs = dict()
-        for known_bigsdb in BIGSdbIndex.KNOWN_BIGSDB_APIS:
-            async with self._http_client.get(f"{known_bigsdb}/db") as response:
-                response_json_databases = await response.json()
-                for database_group in response_json_databases:
-                    for database_info in database_group["databases"]:
-                        if str(database_info["name"]).endswith("seqdef"):
-                            known_seqdef_dbs[database_info["name"]] = known_bigsdb
-        self._known_seqdef_dbs_origin = dict(known_seqdef_dbs)
-        return self._known_seqdef_dbs_origin
-
-    async def get_bigsdb_api_from_seqdefdb(self, seqdef_db_name: str) -> str:
-        known_databases = await self.get_known_seqdef_dbs()
-        if seqdef_db_name not in known_databases:
-            raise ValueError(f"The database \"{seqdef_db_name}\" could not be found.")
-        return known_databases[seqdef_db_name]     
-
-    async def get_schemas_for_seqdefdb(self, seqdef_db_name: str, force: bool = False) -> Mapping[str, int]:
-        if seqdef_db_name in self._seqdefdb_schemas and not force:
-            return self._seqdefdb_schemas[seqdef_db_name] # type: ignore since it's guaranteed to not be none by conditional
-        uri_path = f"{await self.get_bigsdb_api_from_seqdefdb(seqdef_db_name)}/db/{seqdef_db_name}/schemes"
-        async with self._http_client.get(uri_path) as response: 
-            response_json = await response.json()
-            schema_descriptions: Mapping[str, int] = dict()
-            for scheme_definition in response_json["schemes"]:
-                scheme_id: int = int(str(scheme_definition["scheme"]).split("/")[-1])
-                scheme_desc: str = scheme_definition["description"]
-                schema_descriptions[scheme_desc] = scheme_id
-            self._seqdefdb_schemas[seqdef_db_name] = schema_descriptions
-            return self._seqdefdb_schemas[seqdef_db_name] # type: ignore
-
-    async def build_profiler_from_seqdefdb(self, dbseqdef_name: str, schema_id: int) -> BigSDBMLSTProfiler:
-        return BigSDBMLSTProfiler(await self.get_bigsdb_api_from_seqdefdb(dbseqdef_name), dbseqdef_name, schema_id)
-
-    async def close(self):
-        await self._http_client.close()
-
-    async def __aexit__(self, exc_type, exc_value, traceback):
-        await self.close()
-    

src/automlst/engine/remote/databases/ncbi/genbank.py

@@ -1,27 +0,0 @@
-import asyncio
-from Bio import Entrez
-from Bio import SeqIO
-
-# TODO Change this out for a more professional approach
-Entrez.email = "yunyangdeng@outlook.com"
-
-from automlst.engine.data.genomics import AnnotatedString, StringAnnotation
-
-
-async def fetch_ncbi_genbank(genbank_id: str) -> AnnotatedString:
-    with (await asyncio.to_thread(Entrez.efetch, db="nucleotide", id=genbank_id, rettype="gb", retmode="text")) as fetch_stream:
-        record = SeqIO.read(fetch_stream, "genbank")
-        sequence_features = list()
-        for feature in record.features:
-            start = int(feature.location.start)
-            end = int(feature.location.end)
-            qualifiers = feature.qualifiers
-            for qualifier_key in qualifiers:
-                qualifiers[qualifier_key] = set(qualifiers[qualifier_key])
-            sequence_features.append(StringAnnotation(
-                type=feature.type,
-                start=start,
-                end=end+1,  # Position is exclusive
-                feature_properties=qualifiers
-            ))
-        return AnnotatedString(name=genbank_id, sequence=str(record.seq), annotations=sequence_features)

tests/autobigs/engine/analysis/test_bigsdb.py

@@ -0,0 +1,233 @@
+from os import path
+import random
+import re
+from typing import Callable, Collection, Sequence, Union
+from Bio import SeqIO
+import pytest
+from autobigs.engine.analysis import bigsdb
+from autobigs.engine.structures import mlst
+from autobigs.engine.structures.genomics import NamedString
+from autobigs.engine.structures.mlst import Allele, MLSTProfile, NamedMLSTProfile
+from autobigs.engine.exceptions.database import NoBIGSdbExactMatchesException, NoBIGSdbMatchesException
+from autobigs.engine.analysis.bigsdb import BIGSdbIndex, BIGSdbMLSTProfiler, RemoteBIGSdbMLSTProfiler
+
+async def generate_async_iterable(normal_iterable):
+    for dummy_sequence in normal_iterable:
+        yield dummy_sequence
+
+def gene_scrambler(gene: str, mutation_site_count: Union[int, float], alphabet: Sequence[str] = ["A", "T", "C", "G"]):
+    rand = random.Random(gene)
+    if isinstance(mutation_site_count, float):
+        mutation_site_count = int(mutation_site_count * len(gene))
+    random_locations = rand.choices(range(len(gene)), k=mutation_site_count)
+    scrambled = list(gene)
+    for random_location in random_locations:
+        scrambled[random_location] = rand.choice(alphabet)
+    return "".join(scrambled)
+
+def get_first_sequence_from_fasta(resource: str):
+    return str(SeqIO.read(path.join("tests/resources/", resource), "fasta").seq)
+
+def get_multiple_sequences_from_fasta(resource: str):
+    return tuple(SeqIO.parse(path.join("tests/resources/", resource), "fasta"))
+
+bpertussis_tohamaI_profile = MLSTProfile((
+        Allele("adk", "1", None),
+        Allele("fumC", "1", None),
+        Allele("glyA", "1", None),
+        Allele("tyrB", "1", None),
+        Allele("icd", "1", None),
+        Allele("pepA", "1", None),
+        Allele("pgm", "1", None)), "1", "ST-2 complex")
+
+bpertussis_tohamaI_bad_profile = MLSTProfile((
+        Allele("adk", "1", None),
+        Allele("fumC", "2", None),
+        Allele("glyA", "36", None),
+        Allele("tyrB", "4", None),
+        Allele("icd", "4", None),
+        Allele("pepA", "1", None),
+        Allele("pgm", "5", None),
+    ), "unknown", "unknown")
+
+hinfluenzae_2014_102_profile = MLSTProfile((
+        Allele("adk", "28", None),
+        Allele("atpG", "33", None),
+        Allele("frdB", "7", None),
+        Allele("fucK", "18", None),
+        Allele("mdh", "11", None),
+        Allele("pgi", "125", None),
+        Allele("recA", "89", None)
+    ), "478", "unknown")
+
+hinfluenzae_2014_102_bad_profile = MLSTProfile((
+        Allele("adk", "3", None),
+        Allele("atpG", "121", None),
+        Allele("frdB", "6", None),
+        Allele("fucK", "5", None),
+        Allele("mdh", "12", None),
+        Allele("pgi", "4", None),
+        Allele("recA", "5", None)
+    ), "unknown", "unknown")
+
+
+@pytest.mark.parametrize("local_db,database_api,database_name,scheme_id,seq_path,feature_seqs_path,expected_profile,bad_profile", [
+    (False, "https://bigsdb.pasteur.fr/api", "pubmlst_bordetella_seqdef", 3, "tohama_I_bpertussis.fasta", "tohama_I_bpertussis_features.fasta", bpertussis_tohamaI_profile, bpertussis_tohamaI_bad_profile),
+    (False, "https://rest.pubmlst.org", "pubmlst_hinfluenzae_seqdef", 1, "2014-102_hinfluenza.fasta", "2014-102_hinfluenza_features.fasta", hinfluenzae_2014_102_profile, hinfluenzae_2014_102_bad_profile),
+])
+class TestBIGSdbMLSTProfiler:
+    async def test_profiling_results_in_exact_matches_when_exact(self, local_db, database_api, database_name, scheme_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
+        sequence = get_first_sequence_from_fasta(seq_path)
+        async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, scheme_id) as dummy_profiler:
+            expected_alleles = mlst.alleles_to_mapping(expected_profile.alleles)
+            targets_left = set(mlst.alleles_to_mapping(expected_profile.alleles).keys())
+            async for exact_match in dummy_profiler.determine_mlst_allele_variants(query_sequence_strings=[sequence]):
+                assert isinstance(exact_match, Allele)
+                assert exact_match.allele_locus in expected_alleles
+                assert exact_match.allele_variant == expected_alleles[exact_match.allele_locus]
+                targets_left.remove(exact_match.allele_locus)
+
+            assert len(targets_left) == 0
+
+    async def test_sequence_profiling_non_exact_returns_non_exact(self, local_db, database_api, database_name, scheme_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
+        target_sequences = get_multiple_sequences_from_fasta(feature_seqs_path)
+        mlst_targets = {x.lower() for x in mlst.alleles_to_mapping(expected_profile.alleles).keys()}
+        async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, scheme_id) as profiler:
+            for target_sequence in target_sequences:
+                match = re.fullmatch(r".*\[gene=([\w\d]+)\].*", target_sequence.description)
+                if match is None:
+                    continue
+                gene = match.group(1).lower()
+                if gene not in mlst_targets:
+                    continue
+                scrambled = gene_scrambler(str(target_sequence.seq), 0.125)
+                async for partial_match in profiler.determine_mlst_allele_variants([scrambled]):
+                    assert isinstance(partial_match, Allele)
+                    assert partial_match.partial_match_profile is not None
+                    mlst_targets.remove(gene)
+
+            assert len(mlst_targets) == 0
+
+    async def test_profiling_results_in_correct_mlst_st(self, local_db, database_api, database_name, scheme_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
+        async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, scheme_id) as dummy_profiler:
+            mlst_st_data = await dummy_profiler.determine_mlst_st(expected_profile.alleles)
+            assert mlst_st_data is not None
+            assert isinstance(mlst_st_data, MLSTProfile)
+            assert mlst_st_data.clonal_complex == expected_profile.clonal_complex
+            assert mlst_st_data.sequence_type == expected_profile.sequence_type
+
+    async def test_profiling_non_exact_results_in_list_of_mlsts(self, local_db, database_api, database_name, scheme_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
+        dummy_alleles = bad_profile.alleles
+        async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, scheme_id) as dummy_profiler:
+            mlst_profile = await dummy_profiler.determine_mlst_st(dummy_alleles)
+            assert isinstance(mlst_profile, MLSTProfile)
+            assert mlst_profile.clonal_complex == "unknown"
+            assert mlst_profile.sequence_type == "unknown"
+
+
+    async def test_bigsdb_profile_multiple_strings_same_string_twice(self, local_db, database_api, database_name, scheme_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
+        sequence = get_first_sequence_from_fasta(seq_path)
+        dummy_sequences = [[NamedString("seq1", sequence)], [NamedString("seq2", sequence)]]
+        async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, scheme_id) as dummy_profiler:
+            async for named_profile in dummy_profiler.profile_multiple_strings(generate_async_iterable(dummy_sequences)):
+                name, profile = named_profile.name, named_profile.mlst_profile
+                assert isinstance(profile, MLSTProfile)
+                assert profile.clonal_complex == expected_profile.clonal_complex
+                assert profile.sequence_type == expected_profile.sequence_type
+
+    async def test_bigsdb_profile_named_string_no_repeat_name(self, local_db, database_api, database_name, scheme_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
+        sequence = get_first_sequence_from_fasta(seq_path)
+        async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, scheme_id) as dummy_profiler:
+            named_profile = await dummy_profiler.profile_string([NamedString("BX470248.1", sequence)])
+            assert isinstance(named_profile, NamedMLSTProfile)
+            name, profile = named_profile.name, named_profile.mlst_profile
+            assert isinstance(profile, MLSTProfile)
+            assert profile.clonal_complex == expected_profile.clonal_complex
+            assert profile.sequence_type == expected_profile.sequence_type
+            assert name == "BX470248.1"
+
+    async def test_bigsdb_profile_multiple_strings_exactmatch_fail_second_no_stop(self, local_db, database_api, database_name, scheme_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
+        valid_seq = get_first_sequence_from_fasta(seq_path)
+        dummy_sequences = [[NamedString("seq1", valid_seq)], [NamedString("should_fail", gene_scrambler(valid_seq, 0.3))], [NamedString("seq3", valid_seq)]]
+        async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, scheme_id) as dummy_profiler:
+            async for name_profile in dummy_profiler.profile_multiple_strings(generate_async_iterable(dummy_sequences), True):
+                name, profile = name_profile.name, name_profile.mlst_profile
+
+                assert profile is not None
+                if name == "should_fail":
+                    assert profile.clonal_complex == "unknown"
+                    assert profile.sequence_type == "unknown"
+                    assert len(profile.alleles) > 0
+                else:
+                    assert isinstance(profile, MLSTProfile)
+                    assert profile.clonal_complex == expected_profile.clonal_complex
+                    assert profile.sequence_type == expected_profile.sequence_type
+
+    async def test_bigsdb_profile_multiple_strings_nonexact_second_no_stop(self, local_db, database_api, database_name, scheme_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
+        valid_seq = get_first_sequence_from_fasta(seq_path)
+        dummy_sequences = [[NamedString("seq1", valid_seq)], [NamedString("should_fail", gene_scrambler(valid_seq, 0.3))], [NamedString("seq3", valid_seq)]]
+
+        async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, scheme_id) as dummy_profiler:
+            async for named_profile in dummy_profiler.profile_multiple_strings(generate_async_iterable(dummy_sequences), False):
+                name, profile = named_profile.name, named_profile.mlst_profile
+                
+                assert profile is not None
+                if name == "should_fail":
+                    assert profile.clonal_complex == "unknown"
+                    assert profile.sequence_type == "unknown"
+                    assert len(profile.alleles) > 0
+                else:
+                    assert isinstance(profile, MLSTProfile)
+                    assert profile.clonal_complex == expected_profile.clonal_complex
+                    assert profile.sequence_type == expected_profile.sequence_type
+
+class TestBIGSdbIndex:
+
+    async def test_bigsdb_index_all_databases_is_not_empty(self):
+        async with BIGSdbIndex() as bigsdb_index:
+            assert len(await bigsdb_index.get_known_seqdef_dbs()) > 0
+
+    async def test_bigsdb_index_references_pubmlst_correctly(self):
+        async with BIGSdbIndex() as bigsdb_index:
+            assert (await bigsdb_index.get_bigsdb_api_from_seqdefdb("pubmlst_hinfluenzae_seqdef")) == "https://rest.pubmlst.org"
+
+    async def test_bigsdb_index_references_institutpasteur_correctly(self):
+        async with BIGSdbIndex() as bigsdb_index:
+            assert (await bigsdb_index.get_bigsdb_api_from_seqdefdb("pubmlst_bordetella_seqdef")) == "https://bigsdb.pasteur.fr/api"
+
+    async def test_bigsdb_index_get_schemes_for_bordetella(self):
+        async with BIGSdbIndex() as index:
+            schemes = await index.get_schemes_for_seqdefdb(seqdef_db_name="pubmlst_bordetella_seqdef")
+            assert len(schemes.keys()) > 0
+            assert "MLST" in schemes
+            assert isinstance(schemes["MLST"], int)
+
+    async def test_bigsdb_index_get_databases_has_only_seqdef(self):
+        async with BIGSdbIndex() as index:
+            databases = await index.get_known_seqdef_dbs()
+            assert len(databases.keys()) > 0
+            for database_name in databases.keys():
+                assert database_name.endswith("seqdef")
+            assert databases["pubmlst_bordetella_seqdef"] == "https://bigsdb.pasteur.fr/api"
+
+    @pytest.mark.parametrize("local", [
+        (False)
+    ])
+    async def test_bigsdb_index_instantiates_correct_profiler(self, local):
+        sequence = str(SeqIO.read("tests/resources/tohama_I_bpertussis.fasta", "fasta").seq)
+        async with BIGSdbIndex() as bigsdb_index:
+            async with await bigsdb_index.build_profiler_from_seqdefdb(local, "pubmlst_bordetella_seqdef", 3) as profiler:
+                assert isinstance(profiler, BIGSdbMLSTProfiler)
+                profile = await profiler.profile_string(sequence)
+                assert isinstance(profile, MLSTProfile)
+                assert profile.clonal_complex == "ST-2 complex"
+                assert profile.sequence_type == "1"
+
+
+    @pytest.mark.parametrize(["bigsdb_name", "scheme_id", "expected"], [
+        ("pubmlst_bordetella_seqdef", 3, ["adk", "fumC", "glyA", "tyrB", "icd", "pepA", "pgm"])
+    ])
+    async def test_bigsdb_index_fetches_loci_names(self, bigsdb_name, scheme_id, expected):
+        async with BIGSdbIndex() as bigsdb_index:
+            loci = await bigsdb_index.get_scheme_loci(bigsdb_name, scheme_id)
+            assert set(loci) == set(expected)

tests/autobigs/engine/test_reading.py

@@ -0,0 +1,12 @@
+from autobigs.engine.reading import read_fasta
+
+
+async def test_fasta_reader_not_none():
+    named_strings = await read_fasta("tests/resources/tohama_I_bpertussis.fasta")
+    for named_string in named_strings:
+        assert named_string.name is not None
+
+async def test_fasta_reader_name_contains_file_and_id():
+    named_strings = await read_fasta("tests/resources/tohama_I_bpertussis.fasta")
+    for named_string in named_strings:
+        assert named_string.name == "tohama_I_bpertussis.fasta:BX470248.1"

tests/autobigs/engine/test_writing.py

@@ -0,0 +1,70 @@
+from typing import AsyncIterable, Iterable
+
+import pytest
+from autobigs.engine.structures.alignment import AlignmentStats
+from autobigs.engine.writing import alleles_to_text_map, write_mlst_profiles_as_csv
+from autobigs.engine.structures.mlst import Allele, MLSTProfile, NamedMLSTProfile
+import tempfile
+from csv import reader
+from os import path
+
+
+@pytest.fixture
+def dummy_alphabet_mlst_profile():
+    return NamedMLSTProfile("name", MLSTProfile((
+        Allele("A", "1", None),
+        Allele("D", "1", None),
+        Allele("B", "1", None),
+        Allele("C", "1", None),
+        Allele("C", "2", AlignmentStats(90, 10, 0, 90))
+    ), "mysterious", "very mysterious"))
+
+async def iterable_to_asynciterable(iterable: Iterable):
+    for iterated in iterable:
+        yield iterated
+
+async def test_column_order_is_same_as_expected_file(dummy_alphabet_mlst_profile: MLSTProfile):
+    dummy_profiles = [dummy_alphabet_mlst_profile]
+    with tempfile.TemporaryDirectory() as temp_dir:
+        output_path = path.join(temp_dir, "out.csv")
+        await write_mlst_profiles_as_csv(iterable_to_asynciterable(dummy_profiles), output_path, ["A", "D", "B", "C"])
+        with open(output_path) as csv_handle:
+            csv_reader = reader(csv_handle)
+            lines = list(csv_reader)
+            target_columns = lines[0][3:]
+            assert target_columns == sorted(target_columns)
+
+async def test_csv_writing_sample_name_not_repeated_when_single_sequence(dummy_alphabet_mlst_profile):
+    dummy_profiles = [dummy_alphabet_mlst_profile]
+    with tempfile.TemporaryDirectory() as temp_dir:
+        output_path = path.join(temp_dir, "out.csv")
+        await write_mlst_profiles_as_csv(iterable_to_asynciterable(dummy_profiles), output_path, ["A", "D", "B", "C"])
+        with open(output_path) as csv_handle:
+            csv_reader = reader(csv_handle)
+            lines = list(csv_reader)
+            sample_name = lines[1][0]
+            assert sample_name == "name"
+
+
+async def test_alleles_to_text_map_mapping_is_correct(dummy_alphabet_mlst_profile: NamedMLSTProfile):
+    assert dummy_alphabet_mlst_profile.mlst_profile is not None
+    mapping = alleles_to_text_map(dummy_alphabet_mlst_profile.mlst_profile.alleles)
+    expected_mapping = {
+        "A": "1",
+        "B": "1",
+        "C": ("1", "2*"),
+        "D": "1"
+    }
+    for allele_name, allele_ids in mapping.items():
+        assert allele_name in expected_mapping
+        assert allele_ids == expected_mapping[allele_name]
+
+async def test_csv_writing_includes_asterisk_for_non_exact(dummy_alphabet_mlst_profile: NamedMLSTProfile):
+    dummy_profiles = [dummy_alphabet_mlst_profile]
+    with tempfile.TemporaryDirectory() as temp_dir:
+        output_path = path.join(temp_dir, "out.csv")
+        await write_mlst_profiles_as_csv(iterable_to_asynciterable(dummy_profiles), output_path, ["A", "D", "B", "C"])
+        with open(output_path) as csv_handle:
+            csv_reader = reader(csv_handle)
+            lines = list(csv_reader)
+            assert '*' in lines[1][5]

tests/automlst/engine/local/test_abif.py

@@ -1,12 +0,0 @@
-import os
-
-from automlst.engine.local.abif import read_abif, reference_consensus_assembly
-
-async def test_load_sanger_sequence_has_data():
-    assert os.path.exists("tests/resources/1I1_F_P1815443_047.ab1")
-    result_data = await read_abif("tests/resources/1I1_F_P1815443_047.ab1")
-    assert result_data is not None
-
-async def test_consensus_assembly_with_ncbi():
-    consensus = reference_consensus_assembly("ON685494.1", [await read_abif("tests/resources/1I1_F_P1815443_047.ab1"), await read_abif("tests/resources/1I1_R_P1815443_094.ab1")])
-    # TODO complete implementing this

tests/automlst/engine/local/test_fasta.py

@@ -1,7 +0,0 @@
-from automlst.engine.local.fasta import read_fasta
-
-
-async def test_fasta_reader_not_none():
-    named_strings = read_fasta("tests/resources/tohama_I_bpertussis.fasta")
-    async for named_string in named_strings:
-        assert named_string.name == "BX470248.1"

tests/automlst/engine/remote/databases/ncbi/test_genbank.py

@@ -1,5 +0,0 @@
-from automlst.engine.remote.databases.ncbi.genbank import fetch_ncbi_genbank
-
-
-async def test_fetch_ncbi_genbank_with_id_works():
-    assert len((await fetch_ncbi_genbank("CP011448.1")).sequence) > 0 

tests/automlst/engine/remote/databases/test_bigsdb.py

@@ -1,115 +0,0 @@
-from Bio import SeqIO
-from automlst.engine.data.mlst import Allele, MLSTProfile
-from automlst.engine.remote.databases.bigsdb import BIGSdbIndex, BigSDBMLSTProfiler
-
-
-async def test_institutpasteur_profiling_results_in_exact_matches_when_exact():
-    sequence = str(SeqIO.read("tests/resources/tohama_I_bpertussis.fasta", "fasta").seq)
-    async with BigSDBMLSTProfiler(database_api="https://bigsdb.pasteur.fr/api", database_name="pubmlst_bordetella_seqdef", schema_id=3) as dummy_profiler:
-        exact_matches = dummy_profiler.fetch_mlst_allele_variants(sequence_string=sequence)
-        targets_left = {"adk", "fumC", "glyA", "tyrB", "icd", "pepA", "pgm"}
-        async for exact_match in exact_matches:
-            assert isinstance(exact_match, Allele)
-            assert exact_match.allele_variant == '1' # All of Tohama I has allele id I
-            targets_left.remove(exact_match.allele_loci)
-
-        assert len(targets_left) == 0
-
-async def test_institutpasteur_profiling_results_in_correct_mlst_st():
-    async def dummy_allele_generator():
-        dummy_alleles = [
-        Allele("adk", "1"),
-        Allele("fumC", "1"),
-        Allele("glyA", "1"),
-        Allele("tyrB", "1"),
-        Allele("icd", "1"),
-        Allele("pepA", "1"),
-        Allele("pgm", "1"),
-        ]
-        for dummy_allele in dummy_alleles:
-            yield dummy_allele
-    async with BigSDBMLSTProfiler(database_api="https://bigsdb.pasteur.fr/api", database_name="pubmlst_bordetella_seqdef", schema_id=3) as dummy_profiler:
-        mlst_st_data = await dummy_profiler.fetch_mlst_st(dummy_allele_generator())
-        assert mlst_st_data is not None
-        assert isinstance(mlst_st_data, MLSTProfile)
-        assert mlst_st_data.clonal_complex == "ST-2 complex"
-        assert mlst_st_data.sequence_type == "1"
-
-async def test_institutpasteur_sequence_profiling_is_correct():
-    sequence = str(SeqIO.read("tests/resources/tohama_I_bpertussis.fasta", "fasta").seq)
-    async with BigSDBMLSTProfiler(database_api="https://bigsdb.pasteur.fr/api", database_name="pubmlst_bordetella_seqdef", schema_id=3) as dummy_profiler:
-        profile = await dummy_profiler.profile_string(sequence)
-        assert profile is not None
-        assert isinstance(profile, MLSTProfile)
-        assert profile.clonal_complex == "ST-2 complex"
-        assert profile.sequence_type == "1"
-
-
-async def test_pubmlst_profiling_results_in_exact_matches_when_exact():
-    dummy_alleles = {
-        Allele("adk", "1"),
-        Allele("atpG", "1"),
-        Allele("frdB", "1"),
-        Allele("fucK", "1"),
-        Allele("mdh", "1"),
-        Allele("pgi", "1"),
-        Allele("recA", "5"),
-    }
-    sequence = str(SeqIO.read("tests/resources/FDAARGOS_1560.fasta", "fasta").seq)
-    async with BigSDBMLSTProfiler(database_api="https://rest.pubmlst.org/", database_name="pubmlst_hinfluenzae_seqdef", schema_id=1) as dummy_profiler:
-        exact_matches = dummy_profiler.fetch_mlst_allele_variants(sequence_string=sequence)
-        async for exact_match in exact_matches:
-            assert isinstance(exact_match, Allele)
-            dummy_alleles.remove(exact_match)
-
-        assert len(dummy_alleles) == 0
-
-async def test_pubmlst_profiling_results_in_correct_st():
-    async def generate_dummy_targets():
-        dummy_alleles = [
-                Allele("adk", "1"),
-                Allele("atpG", "1"),
-                Allele("frdB", "1"),
-                Allele("fucK", "1"),
-                Allele("mdh", "1"),
-                Allele("pgi", "1"),
-                Allele("recA", "5"),
-            ]
-        for dummy_allele in dummy_alleles:
-            yield dummy_allele
-    async with BigSDBMLSTProfiler(database_api="https://rest.pubmlst.org/", database_name="pubmlst_hinfluenzae_seqdef", schema_id=1) as dummy_profiler:
-        mlst_st_data = await dummy_profiler.fetch_mlst_st(generate_dummy_targets())
-        assert mlst_st_data is not None
-        assert isinstance(mlst_st_data, MLSTProfile)
-        assert mlst_st_data.clonal_complex == "ST-3 complex"
-        assert mlst_st_data.sequence_type == "3"
-
-async def test_pubmlst_sequence_profiling_is_correct():
-    sequence = str(SeqIO.read("tests/resources/FDAARGOS_1560.fasta", "fasta").seq)
-    async with BigSDBMLSTProfiler(database_api="https://rest.pubmlst.org/", database_name="pubmlst_hinfluenzae_seqdef", schema_id=1) as dummy_profiler:
-        profile = await dummy_profiler.profile_string(sequence)
-        assert profile is not None
-        assert isinstance(profile, MLSTProfile)
-        assert profile.clonal_complex == "ST-3 complex"
-        assert profile.sequence_type == "3"
-
-async def test_bigsdb_index_all_databases_is_not_empty():
-    async with BIGSdbIndex() as bigsdb_index:
-        assert len(await bigsdb_index.get_known_seqdef_dbs()) > 0
-
-async def test_bigsdb_index_references_pubmlst_correctly():
-    async with BIGSdbIndex() as bigsdb_index:
-        assert (await bigsdb_index.get_bigsdb_api_from_seqdefdb("pubmlst_hinfluenzae_seqdef")) == "https://rest.pubmlst.org"
-
-async def test_bigsdb_index_references_institutpasteur_correctly():
-    async with BIGSdbIndex() as bigsdb_index:
-        assert (await bigsdb_index.get_bigsdb_api_from_seqdefdb("pubmlst_bordetella_seqdef")) == "https://bigsdb.pasteur.fr/api"
-
-
-async def test_bigsdb_index_instantiates_correct_profiler():
-    sequence = str(SeqIO.read("tests/resources/tohama_I_bpertussis.fasta", "fasta").seq)
-    async with BIGSdbIndex() as bigsdb_index:
-        async with await bigsdb_index.build_profiler_from_seqdefdb("pubmlst_bordetella_seqdef", 3) as profiler:
-            profile = await profiler.profile_string(sequence)
-            assert profile.clonal_complex == "ST-2 complex"
-            assert profile.sequence_type == "1"

tests/resources/B3913_bpertussis_minimized_features.fasta

@@ -0,0 +1,133 @@
+>lcl|CP011447.1_gene_2762 [gene=adk] [locus_tag=B3913_2762] [location=2916440..2917096] [gbkey=Gene]
+ATGCGTCTCATTCTGCTCGGACCGCCCGGAGCCGGCAAAGGCACCCAAGCCGCCTTTCTCACCCAACACT
+ACGGCATCCCGCAGATATCCACCGGTGACATGCTGCGCGCCGCCGTCAAGGCCGGCACGCCGCTGGGCCT
+GGAAGCCAAGAAGGTCATGGACGCGGGCGGCCTGGTCTCGGACGACCTGATCATCGGCCTGGTGCGCGAT
+CGCCTGACCCAGCCCGATTGCGCCAACGGCTACCTGTTCGACGGTTTCCCGCGCACCATCCCGCAGGCCG
+ACGCGCTCAAGAGCGCCGGCATCGCGCTGGATTACGTGGTCGAGATCGAAGTGCCGGAAAGCGACATCAT
+CGAACGCATGAGCGAACGCCGCGTGCACCCGGCCAGCGGCCGCAGCTACCACGTACGCTTCAATCCGCCC
+AAGGCCGAAGGCGTGGACGACGTCACGGGCGAACCGCTGGTGCAGCGCGACGACGACCGCGAGGAAACCG
+TGCGCCATCGTCTCAACGTCTACCAGAACCAGACCCGCCCGCTGGTCGACTACTACTCGTCCTGGGCCCA
+GTCCGATGCCGCCGCGGCGCCCAAGTACCGCAAGATCTCCGGCGTCGGCTCGGTCGACGAAATCAAGAGC
+CGCCTGTCGCAGGCTCTGCAGAGCTAA
+>lcl|CP011447.1_gene_253 [gene=fumC] [locus_tag=B3913_0253] [location=257438..258829] [gbkey=Gene]
+ATGAAAACCCGCACCGAAAAAGACACTTTCGGCCCGATCGAGGTGCCCGAGCAGCACCTGTGGGGCGCGC
+AGACCCAGCGCTCGCTGCATTTCTTCGCGATCTCGACCGAGAAGATGCCGGTGCCGCTGGTCGCCGCCAT
+GGCACGCCTGAAGCGCGCCGCCGCCAAGGTCAACGCCGAGCTGGGCGAGCTGGATCCGCAGGTCGCAGAC
+GCCATCATGCGGGCCGCCGATGAGGTGATCGCCGGCAAGTGGCCCGACGAGTTTCCGCTGTCGGTCTGGC
+AGACCGGCTCGGGCACGCAGAGCAACATGAACATGAACGAGGTGCTGGCCAACCGCGCCTCCGAGCTGCT
+GGGCGGCGAGCGCGGCGAAGGCCGCAAGGTGCACCCCAACGACCACGTGAACCGGGGCCAGTCGTCCAAC
+GATACCTTTCCGACCGCCATGCACGTGGCCGCCGCGGTCGAGGTCGAGCACCGCGTGCTGCCCGCCCTGA
+AGGCGTTGCGCGGCACGCTGGCCGCCAAGAGCGCGGCGTTCTACGACATCGTCAAGATCGGTCGCACCCA
+TTTGCAGGACGCCACCCCGTTGACGCTGGGCCAGGAGATCTCCGGCTACGTGGCGCAGCTGGACCTGGCC
+GAGCAGCAGATCCGCGCGACGCTGGCCGGCCTGCACCAGCTGGCCATCGGCGGCACGGCGGTGGGCACCG
+GCCTGAACGCGCATCCGCAGTTCAGCGCCAAGGTATCGGCCGAACTGGCCCATGACACGGGCAGCGCGTT
+CGTGTCGGCGCCCAACAAGTTCCAGGCGCTGGCTTCGCACGAGGCGCTGCTGTTCGCGCACGGCGCCTTG
+AAGACGCTGGCCGCCGGCCTGATGAAGATCGCCAACGATGTGCGCTGGCTGGCCAGCGGCCCGCGCTCGG
+GGCTGGGCGAAATCAGCATTCCCGAGAACGAGCCGGGCAGCTCCATCATGCCGGGCAAGGTCAACCCGAC
+CCAGTGCGAAGCCGTCACGATGCTGGCCGCGCAGGTCATGGGCAACGACGTGGCCATCAATGTCGGCGGG
+GCCAGCGGCAACTTCGAGCTGAACGTCTTCAAGCCGCTGGTGATCCACAATTTCCTGCAGTCGGTGCGCC
+TGCTGGCCGACGGCATGGTCAGCTTCGACAAGCACTGCGCGGCCGGCATCGAGCCCAACCGCGAGCGCAT
+CACCGAGCTGGTCGAGCGTTCGCTGATGCTGGTGACTGCGCTCAACCCGCACATCGGCTACGACAAGGCC
+GCGCAGATCGCCAAGAAGGCGCACAAGGAAAACCTGTCGCTGAAAGAGGCGGCGCTGGCGCTGGGGCACC
+TGACCGAGGCGCAGTTCGCCGAGTGGGTGGTGCCGGGCGACATGACCAACGCGCGCCGCTAG
+>lcl|CP011447.1_gene_2963 [gene=glyA] [locus_tag=B3913_2963] [location=complement(3129365..3130612)] [gbkey=Gene]
+ATGTTCAACCGCAACCTGACCCTCGACCAGGTGGATCCCGACGTCTGGGCCGCCATCCAGAAAGAAGACG
+TACGCCAGGAACAGCACATCGAGCTGATCGCGTCCGAGAACTACGCCAGCCCCGCCGTGATGCAGGCCCA
+GGGCACGCAACTGACCAACAAGTATGCGGAAGGCTACCCGGGCAAGCGCTACTACGGCGGTTGCGAGTAC
+GTCGACGTGGTCGAGCAGCTGGCCATCGACCGCCTGAAGCAGATTTTCGGCGCCGAGGCCGCCAACGTGC
+AGCCGAACTCCGGCTCGCAGGCCAACCAGGGCGTGTACATGGCGGTGCTCAAGCCGGGCGATACCGTGCT
+GGGCATGAGCCTGGCCGAAGGCGGTCACCTGACGCACGGCGCGTCGGTCAACGCCTCGGGCAAGCTGTAC
+AACTTCGTGCCCTACGGCCTGGACGCCGACGAGGTGCTGGACTACGCCCAGGTCGAGCGGCTGACCAAGG
+AACACAAGCCCAAGCTGATCGTGGCCGGCGCCTCCGCGTACGCGCTGCACATCGACTTCGAGCGCATGGC
+GCGCATCGCCCACGACAACGGCGCGCTGTTCATGGTGGACATCGCCCACTATGCCGGCCTGGTGGCCGGC
+GGCGCCTATCCCAACCCGGTGCCGCACGCCGATTTCGTCACCTCCACCACGCACAAGTCGCTGCGCGGCC
+CGCGCGGCGGCGTCATCATGATGAAGGCCGAGTTCGAGAAGGCCGTCAATTCGGCCATCTTCCCGGGCAT
+CCAGGGCGGTCCGCTGATGCACGTCATCGCGGCCAAGGCCGTGGCCTTCAAGGAAGCGCTGTCGCCCGAG
+TTCCAGGATTACGCCCAGCAGGTCGTCAAGAACGCCAAGGTGCTGGCCGATACGCTGGTCAAGCGCGGCC
+TGCGCATCGTGTCGGGCAGGACCGAAAGCCACGTCATGCTGGTGGACCTGCGTCCCAAGGGCATTACCGG
+CAAGGAAGCGGAAGCGGTGCTGGGCCAGGCCCACATCACGGTCAACAAGAACGCCATTCCCAACGACCCG
+GAAAAGCCCTTCGTGACCAGCGGCATCCGCCTGGGCACTCCGGCCATGACCACCCGCGGCTTCAAGGAGG
+CCGAGGCCGAGCTGACCGCCAACCTGATCGCCGACGTGCTGGACAATCCGCGCGACGAGGCGAACATCGC
+CGCGGTGCGCGCGCGGGTCAATGAACTGACCGCCCGCCTGCCCGTCTACGGCAACTGA
+>lcl|CP011447.1_gene_2473 [gene=icd] [locus_tag=B3913_2473] [location=complement(2605674..2606930)] [gbkey=Gene]
+ATGTCCTATCAACATATCAAGGTTCCCACTGGGGGCCAAAAAATCACGGTCAACGCCGATTACTCGCTGA
+ATGTGCCCGATCAGGTCATCATTCCGGTCATCGAGGGTGACGGTACGGGCGCCGACATCACGCCGGTGAT
+GATTAAGGTCGTCGACGCGGCCGTGCAGAAGGCCTATGCGGGCAAGCGCAAGATCCACTGGATGGAAGTC
+TACGCCGGCGAGAAGGCCACCAAGGTCTACGGCCCGGACGTCTGGCTGCCCGAGGAAACCCTCGACGCCG
+TCAAGGACTACGTGGTGTCGATCAAGGGTCCGCTGACCACGCCGGTCGGCGGCGGCATCCGTTCGCTGAA
+CGTGGCGCTGCGCCAGCAGCTGGACCTGTATGTCTGCCTGCGCCCGGTGCGCTACTTCAAGGGCGTGCCC
+TCGCCGGTGCGCGAGCCCGAGAAGACCGACATGGTCATCTTCCGCGAGAACTCGGAAGACATCTACGCGG
+GCATCGAGTACATGGCCGAGTCCGAGCAGGCCAAGGACCTGATCCAGTACCTGCAGACCAAGCTGGGCGT
+GACCAAGATCCGCTTCCCGAACACCTCGTCGATCGGCATCAAGCCGGTTTCGCGCGAAGGCACCGAGCGC
+CTGGTGCGCAAGGCGCTGCAGTACGCCATCGACAATGACCGCGCCTCGGTGACCCTGGTCCACAAGGGCA
+ACATCATGAAGTTCACGGAAGGCGGCTTCCGCGACTGGGGCTACGCCCTGGCCCAGAACGAGTTCGGCGC
+GCAGCCGATCGACGGCGGCCCGTGGTGCAAGTTCAAGAATCCCAAGACGGGTCGCGAGATCATCGTCAAG
+GATTCGATCGCCGACGCCTTCCTGCAGCAGATCCTGCTGCGTCCGGCCGAATACGACGTGATCGCCACGC
+TGAACCTGAACGGCGACTACATCTCCGACGCGCTGGCCGCGCAAGTGGGCGGCATCGGCATTGCCCCGGG
+CGCCAACCTGTCGGATTCCGTGGCCATGTTCGAAGCCACCCACGGCACCGCGCCGAAGTACGCGGGCAAG
+GACTACGTGAACCCCGGTTCCGAAATCCTGTCGGCCGAAATGATGCTGCGCCACATGGGCTGGACCGAGG
+CCGCCGACCTGATCATCGCCAGCATGGAGAAATCCATCCTGTCCAAGAAGGTCACCTATGACTTCGCCCG
+TCTGCTCGAAGGCGCCACCCAGGTGTCGTGCTCGGGCTTCGGTCAGGTCATGATCGACAATATGTAA
+>lcl|CP011447.1_gene_2403 [gene=pepA] [locus_tag=B3913_2403] [location=2531836..2533335] [gbkey=Gene]
+ATGGAATTTAGCACACAGACCACTGCCTCCCTGCATCAGATCAAGACTGCGGCCCTGGCCGTCGGCGTCT
+TCGCCGACGGCGTGCTCAGCGCCGCCGCCGAAGTCATCGACCGCGCCAGCCACGGTGCCGTGGCCGCCGT
+GGTGAAAAGCGAGTTCCGCGGCCGCACCGGCAGCACGCTGGTGCTGCGCAGCCTGGCCGGCGTCAGCGCC
+CAGCGCGTGGTGCTGGTGGGCCTGGGCAAGCAGGCCGAATACAACGCCCGCGCGCACGCCAGCGCCGAAC
+AGGCGTTCGCCGCGGCGTGCGTCGCGGCCCAGGTGGGCGAAGGCGTGTCGACCCTGGCCGGCGTGGCCAT
+CGAGGGCGTGCCGGTGCGCGCCCGCGCGCGCAGCGCCGCCATCGCCGCGGGCGCGGCGGCCTACCATTAC
+GATGCGACGTTCGGCAAGGCCAATCGCGACGCCCGCCCCAGGTTGAAGAAAATCGTCCAGGTGGTCGACC
+GCGCGGCCTCCGCGCAGGCGCAGCTGGGCCTGCGCGAAGGCGCGGCCATCGCCCACGGCATGGAATTGAC
+CCGCACGCTGGGCAACCTGCCCGGCAACGTGTGCACGCCGGCCTATCTCGGCAATACCGCCAAGAAACTG
+GCGCGCGAATTCAAGAGCCTCAAGGTCGAGGTGCTCGAACGCAAGCAGGTCGAGGCGCTGGGCATGGGCT
+CGTTCCTCTCGGTCGCGCGCGGCTCGGAAGAACCGCTGCGCTTCATCGTGCTGCGCCATGCCGGCAAGCC
+CGCCAAGAAGGACAAGGCCGGCCCGGTCGTCCTGGTGGGCAAGGGCATCACCTTCGATGCTGGCGGCATC
+TCGCTCAAGCCGGCCGCCACGATGGACGAAATGAAGTACGACATGTGCGGCGCGGCCAGCGTGCTGGGCA
+CGTTCCGCGCCCTGGCCGAGCTGGAGCTGCCGCTGGATGTGGTGGGCCTGATCGCGGCGTGCGAGAACCT
+GCCCAGCGGCAAGGCCAACAAGCCCGGCGACGTGGTCACCAGCATGTCGGGCCAGACCATCGAGATCCTC
+AACACCGACGCCGAAGGCCGCCTGGTGCTGTGCGATGCCCTGACCTACGCCGAGCGCTTCAAGCCCGCGG
+CCGTGATCGACATCGCCACGTTGACCGGCGCCTGCGTGGTAGCCCTGGGCAACGTCAATAGCGGCCTGTT
+CTCCAAGGACGACGCGCTGGCCGACGCGCTGCTGGCCGCCAGCCGCCAGTCGCTCGACCCGGCCTGGCGC
+CTGCCGCTGGACGATGCCTACCAGGACCAGCTCAAGTCCAACTTCGCCGACATCGCCAACATCGGCGGCC
+CCCCGGCCGGCGCGGTCACGGCGGCCTGCTTCCTGTCGCGCTTCACCAAGGCTTATCCGTGGGCGCACCT
+GGACATCGCCGGCACGGCCTGGCGCGGCGGCAAGGACAAGGGCGCCACCGGCCGGCCGGTGCCGCTGCTG
+ATGCAGTACCTGCTGGACCAGGCAGGCTGA
+>lcl|CP011447.1_gene_3165 [gene=pgm] [locus_tag=B3913_3165] [location=3355021..3356403] [gbkey=Gene]
+GTGGCGCACCCCTTTCCCGCATCGGTCTACAAGGCGTACGACATCCGTGGCTCGGTTCCCGACCAGCTCG
+ACCCGGTATTCGCCCGGGCGCTGGGCCGCGCCCTGGCCGCCAGCGCCCGCGCGCAGGGCATCGGCGCCCT
+GGTGGTCGGCCGCGACGGCCGCCTGAGCAGCCCCGACCTGGCCGGCGCGCTGCAGGAAGGCATCATGGAA
+GGCGGCGTGGACACCCTGGACATCGGCCAGGTGCCCACGCCGCTGGTCTATTTCGCGGCGCACATCCAGG
+GCACGGGCTCGGGCGTGGCGGTCACCGGCAGCCACAACCCGCCGCAGTACAACGGCTTCAAGATGATGAT
+GGGCGGCCAGGCCCTGTACGGCCCGGCCGTGCAGGCGCTGCGCCCGGCCATGCTGGCGCCGGCTGCGGCG
+CCGGGCACCTGGGGCGAACGCCGCCAGCTCGATGTCGTCCCCGCCTATATCGAGCGCATCGTGTCCGACG
+TGAAGCTGGCGCGCCCCATGAAGATCGCCGTCGACTGCGGCAATGGCGTGGCCGGCGCCCTGGCGCCGCA
+ACTGTTCCGCGCGCTGGGTTGCGAAGTGGACGAGCTCTATTGCGAGGTCGACGGCACGTTTCCCAACCAC
+CATCCCGACCCGGCCGAACCGCGCAACCTGCAGGACCTGATCGCCCATGTCACCAGCACCGACTGCGAGC
+TGGGCCTGGCCTTCGACGGCGACGGCGACCGCCTCGGCGTGGTGACCAAGTCCGGCCAGATCATCTGGCC
+CGACCGCCAGCTGATCCTGTTCGCCCGCGACGTGCTGGCCCGCTGTCCCGGCGCGACCATCATCTATGAC
+GTCAAGTGCAGCCAGCACGTGGGCGTGGCCATCGAGCAAAGCGGCGGCGTGCCGCTGATGTGGCAGACTG
+GCCATTCGCTGGTGAAGGCCAAGCTGGCCGAGACCGGCGCGCCGCTGGCCGGCGAGATGAGCGGCCATAT
+CTTCTTCAAGGAGCGCTGGTACGGCTTCGACGACGGCCTGTACACCGGCGCCCGCCTGCTGGAAATCGTC
+TCCCGCGAAACCGATGCGTCGCGCCCGCTGGAGGCCCTGCCGCAGGCGCTGTCGACCCCCGAGCTCAAGC
+TGGAGATGGCCGAGGGCGAGCCGCATGCGCTGATCGCCGCCCTGCAGCAGCAGGGCGAGTTCGCCAGCGC
+CAGCCGGCTGGTTACGATAGACGGCGTGCGCGCGGAATACCCGGACGGCTTCGGGCTGGCGCGCGCCTCC
+AATACCACCCCCGTCGTCGTGCTGCGCTTCGAAGCGGAGACCGAGCCGGGCCTGGCCCGCATCCAGCAGG
+AATTCCGCCAGCAGCTGCTGCGGCTGGCTCCGCAAGCCAAACTGCCCTTCTGA
+>lcl|CP011447.1_gene_2110 [gene=tyrB] [locus_tag=B3913_2110] [location=2214524..2215726] [gbkey=Gene]
+ATGAGCACTCTTTTCGCTTCCGTCGAACTCGCGCCGCGCGACCCCATTCTTGGCCTGAACGAACAGTACA
+ACGCCGATACCCGTCCCGGCAAAGTGAACCTGGGCGTGGGCGTGTACTACGACGACGAAGGCCGCATCCC
+GCTGCTTCAGGCCGTGCGCAAGGCCGAGGTGGCCCGCATCGAAGCCGCCGCCGCCCGCGGCTATCTGCCG
+ATCGAAGGCATCGCGGGGTACAACAAGGGTGCGCAGGCGCTGCTGCTGGGCGCCGACTCGCCGCTGGCCG
+CCGAAGGCCGCGTGCTGACCGCGCAGGCCCTGGGCGGCACCGGCGCGCTGAAGATCGGCGCCGACTTCCT
+GCGCCAGCTGCTGCCGCAGTCCAAGGTCCTCATCAGCGACCCCAGCTGGGAAAACCACCGCGCCCTGTTC
+GAGCGCGCCGGCTTCCCGGTCGAGACCTACGCTTATTACGATGCCGCCACCCATGGCCTGAACTTCGAAG
+CCATGCTGGCCGCCCTGCAGGCCGCGCCCGAACAGACCATCGTGGTGCTGCACGCCTGCTGCCACAACCC
+GACCGGCGTCGATCCCACGCCGCAACAGTGGGAACAGATCGCCGCCGTGGTCAAGGCGCGCAACCTGGTG
+CCGTTCCTCGACATCGCCTACCAGGGCTTCGGCGAAGGCCTGGAGCAGGACGCCGCCGTGGTGCGCATGT
+TCGCCGAGCTCGACCTGACCATGTTCATCAGCTCGTCGTTCTCCAAGTCCTTCTCGCTGTATGGCGAGCG
+GGTCGGGGCCCTGACCGTGGTGGCCGGCAGCAAGGACGAGGCCGCCCGCGTGCTCAGCCAGCTCAAGCGC
+GTGATCCGCACCAACTACTCCAACCCGCCCACCCACGGCGGCACCGTGGTGTCCACGGTCCTGAACACAC
+CCGAGCTGTTCGCGCTCTGGGAAAATGAACTGGCCGGCATGCGCGACCGCATCCGCCTGATGCGCAAGGA
+GCTGGTCGAGAAGATCAAGACCCAGGGCGTGGCGCAGGACTTCAGCTTCGTGCTGGCGCAGCGCGGCATG
+TTCTCGTACTCGGGCCTGACCGCCGCCCAGGTCGATCGCCTGCGCGAAGAGCACGGCATCTACGCGGTCT
+CCAGCGGCCGCATCTGCGTGGCCGCGCTCAACAGCCGCAACATCGACGCGGTCGCGGCCGGCATCGCCGC
+GGTGCTGAAGTAG

tests/resources/B3921_bpertussis_minimized_features.fasta

@@ -0,0 +1,133 @@
+>lcl|CP011448.1_cds_ALH77808.1_2459 [gene=adk] [locus_tag=B3921_2764] [protein=adenylate kinase] [protein_id=ALH77808.1] [location=2918521..2919177] [gbkey=CDS]
+ATGCGTCTCATTCTGCTCGGACCGCCCGGAGCCGGCAAAGGCACCCAAGCCGCCTTTCTCACCCAACACT
+ACGGCATCCCGCAGATATCCACCGGTGACATGCTGCGCGCCGCCGTCAAGGCCGGCACGCCGCTGGGCCT
+GGAAGCCAAGAAGGTCATGGACGCGGGCGGCCTGGTCTCGGACGACCTGATCATCGGCCTGGTGCGCGAT
+CGCCTGACCCAGCCCGATTGCGCCAACGGCTACCTGTTCGACGGTTTCCCGCGCACCATCCCGCAGGCCG
+ACGCGCTCAAGAGCGCCGGCATCGCGCTGGATTACGTGGTCGAGATCGAAGTGCCGGAAAGCGACATCAT
+CGAACGCATGAGCGAACGCCGCGTGCACCCGGCCAGCGGCCGCAGCTACCACGTACGCTTCAATCCGCCC
+AAGGCCGAAGGCGTGGACGACGTCACGGGCGAACCGCTGGTGCAGCGCGACGACGACCGCGAGGAAACCG
+TGCGCCATCGTCTCAACGTCTACCAGAACCAGACCCGCCCGCTGGTCGACTACTACTCGTCCTGGGCCCA
+GTCCGATGCCGCCGCGGCGCCCAAGTACCGCAAGATCTCCGGCGTCGGCTCGGTCGACGAAATCAAGAGC
+CGCCTGTCGCAGGCTCTGCAGAGCTAA
+>lcl|CP011448.1_cds_ALH75563.1_214 [gene=fumC] [locus_tag=B3921_0253] [protein=fumarate hydratase] [protein_id=ALH75563.1] [location=257428..258819] [gbkey=CDS]
+ATGAAAACCCGCACCGAAAAAGACACTTTCGGCCCGATCGAGGTGCCCGAGCAGCACCTGTGGGGCGCGC
+AGACCCAGCGCTCGCTGCATTTCTTCGCGATCTCGACCGAGAAGATGCCGGTGCCGCTGGTCGCCGCCAT
+GGCACGCCTGAAGCGCGCCGCCGCCAAGGTCAACGCCGAGCTGGGCGAGCTGGATCCGCAGGTCGCAGAC
+GCCATCATGCGGGCCGCCGATGAGGTGATCGCCGGCAAGTGGCCCGACGAGTTTCCGCTGTCGGTCTGGC
+AGACCGGCTCGGGCACGCAGAGCAACATGAACATGAACGAGGTGCTGGCCAACCGCGCCTCCGAGCTGCT
+GGGCGGCGAGCGCGGCGAAGGCCGCAAGGTGCACCCCAACGACCACGTGAACCGGGGCCAGTCGTCCAAC
+GATACCTTTCCGACCGCCATGCACGTGGCCGCCGCGGTCGAGGTCGAGCACCGCGTGCTGCCCGCCCTGA
+AGGCGTTGCGCGGCACGCTGGCCGCCAAGAGCGCGGCGTTCTACGACATCGTCAAGATCGGTCGCACCCA
+TTTGCAGGACGCCACCCCGTTGACGCTGGGCCAGGAGATCTCCGGCTACGTGGCGCAGCTGGACCTGGCC
+GAGCAGCAGATCCGCGCGACGCTGGCCGGCCTGCACCAGCTGGCCATCGGCGGCACGGCGGTGGGCACCG
+GCCTGAACGCGCATCCGCAGTTCAGCGCCAAGGTATCGGCCGAACTGGCCCATGACACGGGCAGCGCGTT
+CGTGTCGGCGCCCAACAAGTTCCAGGCGCTGGCTTCGCACGAGGCGCTGCTGTTCGCGCACGGCGCCTTG
+AAGACGCTGGCCGCCGGCCTGATGAAGATCGCCAACGATGTGCGCTGGCTGGCCAGCGGCCCGCGCTCGG
+GGCTGGGCGAAATCAGCATTCCCGAGAACGAGCCGGGCAGCTCCATCATGCCGGGCAAGGTCAACCCGAC
+CCAGTGCGAAGCCGTCACGATGCTGGCCGCGCAGGTCATGGGCAACGACGTGGCCATCAATGTCGGCGGG
+GCCAGCGGCAACTTCGAGCTGAACGTCTTCAAGCCGCTGGTGATCCACAATTTCCTGCAGTCGGTGCGCC
+TGCTGGCCGACGGCATGGTCAGCTTCGACAAGCACTGCGCGGCCGGCATCGAGCCCAACCGCGAGCGCAT
+CACCGAGCTGGTCGAGCGTTCGCTGATGCTGGTGACTGCGCTCAACCCGCACATCGGCTACGACAAGGCC
+GCGCAGATCGCCAAGAAGGCGCACAAGGAAAACCTGTCGCTGAAAGAGGCGGCGCTGGCGCTGGGGCACC
+TGACCGAGGCGCAGTTCGCCGAGTGGGTGGTGCCGGGCGACATGACCAACGCGCGCCGCTAG
+>lcl|CP011448.1_cds_ALH77981.1_2632 [gene=glyA] [locus_tag=B3921_2965] [protein=serine hydroxymethyltransferase] [protein_id=ALH77981.1] [location=complement(3131372..3132619)] [gbkey=CDS]
+ATGTTCAACCGCAACCTGACCCTCGACCAGGTGGATCCCGACGTCTGGGCCGCCATCCAGAAAGAAGACG
+TACGCCAGGAACAGCACATCGAGCTGATCGCGTCCGAGAACTACGCCAGCCCCGCCGTGATGCAGGCCCA
+GGGCACGCAACTGACCAACAAGTATGCGGAAGGCTACCCGGGCAAGCGCTACTACGGCGGTTGCGAGTAC
+GTCGACGTGGTCGAGCAGCTGGCCATCGACCGCCTGAAGCAGATTTTCGGCGCCGAGGCCGCCAACGTGC
+AGCCGAACTCCGGCTCGCAGGCCAACCAGGGCGTGTACATGGCGGTGCTCAAGCCGGGCGATACCGTGCT
+GGGCATGAGCCTGGCCGAAGGCGGTCACCTGACGCACGGCGCGTCGGTCAACGCCTCGGGCAAGCTGTAC
+AACTTCGTGCCCTACGGCCTGGACGCCGACGAGGTGCTGGACTACGCCCAGGTCGAGCGGCTGACCAAGG
+AACACAAGCCCAAGCTGATCGTGGCCGGCGCCTCCGCGTACGCGCTGCACATCGACTTCGAGCGCATGGC
+GCGCATCGCCCACGACAACGGCGCGCTGTTCATGGTGGACATCGCCCACTATGCCGGCCTGGTGGCCGGC
+GGCGCCTATCCCAACCCGGTGCCGCACGCCGATTTCGTCACCTCCACCACGCACAAGTCGCTGCGCGGCC
+CGCGCGGCGGCGTCATCATGATGAAGGCCGAGTTCGAGAAGGCCGTCAATTCGGCCATCTTCCCGGGCAT
+CCAGGGCGGTCCGCTGATGCACGTCATCGCGGCCAAGGCCGTGGCCTTCAAGGAAGCGCTGTCGCCCGAG
+TTCCAGGATTACGCCCAGCAGGTCGTCAAGAACGCCAAGGTGCTGGCCGATACGCTGGTCAAGCGCGGCC
+TGCGCATCGTGTCGGGCAGGACCGAAAGCCACGTCATGCTGGTGGACCTGCGTCCCAAGGGCATTACCGG
+CAAGGAAGCGGAAGCGGTGCTGGGCCAGGCCCACATCACGGTCAACAAGAACGCCATTCCCAACGACCCG
+GAAAAGCCCTTCGTGACCAGCGGCATCCGCCTGGGCACTCCGGCCATGACCACCCGCGGCTTCAAGGAGG
+CCGAGGCCGAGCTGACCGCCAACCTGATCGCCGACGTGCTGGACAATCCGCGCGACGAGGCGAACATCGC
+CGCGGTGCGCGCGCGGGTCAATGAACTGACCGCCCGCCTGCCCGTCTACGGCAACTGA
+>lcl|CP011448.1_cds_ALH77547.1_2198 [gene=icd] [locus_tag=B3921_2474] [protein=isocitrate dehydrogenase] [protein_id=ALH77547.1] [location=complement(2606706..2607962)] [gbkey=CDS]
+ATGTCCTATCAACATATCAAGGTTCCCACTGGGGGCCAAAAAATCACGGTCAACGCCGATTACTCGCTGA
+ATGTGCCCGATCAGGTCATCATTCCGGTCATCGAGGGTGACGGTACGGGCGCCGACATCACGCCGGTGAT
+GATTAAGGTCGTCGACGCGGCCGTGCAGAAGGCCTATGCGGGCAAGCGCAAGATCCACTGGATGGAAGTC
+TACGCCGGCGAGAAGGCCACCAAGGTCTACGGCCCGGACGTCTGGCTGCCCGAGGAAACCCTCGACGCCG
+TCAAGGACTACGTGGTGTCGATCAAGGGTCCGCTGACCACGCCGGTCGGCGGCGGCATCCGTTCGCTGAA
+CGTGGCGCTGCGCCAGCAGCTGGACCTGTATGTCTGCCTGCGCCCGGTGCGCTACTTCAAGGGCGTGCCC
+TCGCCGGTGCGCGAGCCCGAGAAGACCGACATGGTCATCTTCCGCGAGAACTCGGAAGACATCTACGCGG
+GCATCGAGTACATGGCCGAGTCCGAGCAGGCCAAGGACCTGATCCAGTACCTGCAGACCAAGCTGGGCGT
+GACCAAGATCCGCTTCCCGAACACCTCGTCGATCGGCATCAAGCCGGTTTCGCGCGAAGGCACCGAGCGC
+CTGGTGCGCAAGGCGCTGCAGTACGCCATCGACAATGACCGCGCCTCGGTGACCCTGGTCCACAAGGGCA
+ACATCATGAAGTTCACGGAAGGCGGCTTCCGCGACTGGGGCTACGCCCTGGCCCAGAACGAGTTCGGCGC
+GCAGCCGATCGACGGCGGCCCGTGGTGCAAGTTCAAGAATCCCAAGACGGGTCGCGAGATCATCGTCAAG
+GATTCGATCGCCGACGCCTTCCTGCAGCAGATCCTGCTGCGTCCGGCCGAATACGACGTGATCGCCACGC
+TGAACCTGAACGGCGACTACATCTCCGACGCGCTGGCCGCGCAAGTGGGCGGCATCGGCATTGCCCCGGG
+CGCCAACCTGTCGGATTCCGTGGCCATGTTCGAAGCCACCCACGGCACCGCGCCGAAGTACGCGGGCAAG
+GACTACGTGAACCCCGGTTCCGAAATCCTGTCGGCCGAAATGATGCTGCGCCACATGGGCTGGACCGAGG
+CCGCCGACCTGATCATCGCCAGCATGGAGAAATCCATCCTGTCCAAGAAGGTCACCTATGACTTCGCCCG
+TCTGCTCGAAGGCGCCACCCAGGTGTCGTGCTCGGGCTTCGGTCAGGTCATGATCGACAATATGTAA
+>lcl|CP011448.1_cds_ALH77480.1_2131 [gene=pepA] [locus_tag=B3921_2404] [protein=leucyl aminopeptidase] [protein_id=ALH77480.1] [location=2532868..2534367] [gbkey=CDS]
+ATGGAATTTAGCACACAGACCACTGCCTCCCTGCATCAGATCAAGACTGCGGCCCTGGCCGTCGGCGTCT
+TCGCCGACGGCGTGCTCAGCGCCGCCGCCGAAGTCATCGACCGCGCCAGCCACGGTGCCGTGGCCGCCGT
+GGTGAAAAGCGAGTTCCGCGGCCGCACCGGCAGCACGCTGGTGCTGCGCAGCCTGGCCGGCGTCAGCGCC
+CAGCGCGTGGTGCTGGTGGGCCTGGGCAAGCAGGCCGAATACAACGCCCGCGCGCACGCCAGCGCCGAAC
+AGGCGTTCGCCGCGGCGTGCGTCGCGGCCCAGGTGGGCGAAGGCGTGTCGACCCTGGCCGGCGTGGCCAT
+CGAGGGCGTGCCGGTGCGCGCCCGCGCGCGCAGCGCCGCCATCGCCGCGGGCGCGGCGGCCTACCATTAC
+GATGCGACGTTCGGCAAGGCCAATCGCGACGCCCGCCCCAGGTTGAAGAAAATCGTCCAGGTGGTCGACC
+GCGCGGCCTCCGCGCAGGCGCAGCTGGGCCTGCGCGAAGGCGCGGCCATCGCCCACGGCATGGAATTGAC
+CCGCACGCTGGGCAACCTGCCCGGCAACGTGTGCACGCCGGCCTATCTCGGCAATACCGCCAAGAAACTG
+GCGCGCGAATTCAAGAGCCTCAAGGTCGAGGTGCTCGAACGCAAGCAGGTCGAGGCGCTGGGCATGGGCT
+CGTTCCTCTCGGTCGCGCGCGGCTCGGAAGAACCGCTGCGCTTCATCGTGCTGCGCCATGCCGGCAAGCC
+CGCCAAGAAGGACAAGGCCGGCCCGGTCGTCCTGGTGGGCAAGGGCATCACCTTCGATGCTGGCGGCATC
+TCGCTCAAGCCGGCCGCCACGATGGACGAAATGAAGTACGACATGTGCGGCGCGGCCAGCGTGCTGGGCA
+CGTTCCGCGCCCTGGCCGAGCTGGAGCTGCCGCTGGATGTGGTGGGCCTGATCGCGGCGTGCGAGAACCT
+GCCCAGCGGCAAGGCCAACAAGCCCGGCGACGTGGTCACCAGCATGTCGGGCCAGACCATCGAGATCCTC
+AACACCGACGCCGAAGGCCGCCTGGTGCTGTGCGATGCCCTGACCTACGCCGAGCGCTTCAAGCCCGCGG
+CCGTGATCGACATCGCCACGTTGACCGGCGCCTGCGTGGTAGCCCTGGGCAACGTCAATAGCGGCCTGTT
+CTCCAAGGACGACGCGCTGGCCGACGCGCTGCTGGCCGCCAGCCGCCAGTCGCTCGACCCGGCCTGGCGC
+CTGCCGCTGGACGATGCCTACCAGGACCAGCTCAAGTCCAACTTCGCCGACATCGCCAACATCGGCGGCC
+CCCCGGCCGGCGCGGTCACGGCGGCCTGCTTCCTGTCGCGCTTCACCAAGGCTTATCCGTGGGCGCACCT
+GGACATCGCCGGCACGGCCTGGCGCGGCGGCAAGGACAAGGGCGCCACCGGCCGGCCGGTGCCGCTGCTG
+ATGCAGTACCTGCTGGACCAGGCAGGCTGA
+>lcl|CP011448.1_cds_ALH78163.1_2814 [gene=pgm] [locus_tag=B3921_3166] [protein=phosphoglucomutase] [protein_id=ALH78163.1] [location=3355979..3357361] [gbkey=CDS]
+GTGGCGCACCCCTTTCCCGCATCGGTCTACAAGGCGTACGACATCCGTGGCTCGGTTCCCGACCAGCTCG
+ACCCGGTATTCGCCCGGGCGCTGGGCCGCGCCCTGGCCGCCAGCGCCCGCGCGCAGGGCATCGGCGCCCT
+GGTGGTCGGCCGCGACGGCCGCCTGAGCAGCCCCGACCTGGCCGGCGCGCTGCAGGAAGGCATCATGGAA
+GGCGGCGTGGACACCCTGGACATCGGCCAGGTGCCCACGCCGCTGGTCTATTTCGCGGCGCACATCCAGG
+GCACGGGCTCGGGCGTGGCGGTCACCGGCAGCCACAACCCGCCGCAGTACAACGGCTTCAAGATGATGAT
+GGGCGGCCAGGCCCTGTACGGCCCGGCCGTGCAGGCGCTGCGCCCGGCCATGCTGGCGCCGGCTGCGGCG
+CCGGGCACCTGGGGCGAACGCCGCCAGCTCGATGTCGTCCCCGCCTATATCGAGCGCATCGTGTCCGACG
+TGAAGCTGGCGCGCCCCATGAAGATCGCCGTCGACTGCGGCAATGGCGTGGCCGGCGCCCTGGCGCCGCA
+ACTGTTCCGCGCGCTGGGTTGCGAAGTGGACGAGCTCTATTGCGAGGTCGACGGCACGTTTCCCAACCAC
+CATCCCGACCCGGCCGAACCGCGCAACCTGCAGGACCTGATCGCCCATGTCACCAGCACCGACTGCGAGC
+TGGGCCTGGCCTTCGACGGCGACGGCGACCGCCTCGGCGTGGTGACCAAGTCCGGCCAGATCATCTGGCC
+CGACCGCCAGCTGATCCTGTTCGCCCGCGACGTGCTGGCCCGCTGTCCCGGCGCGACCATCATCTATGAC
+GTCAAGTGCAGCCAGCACGTGGGCGTGGCCATCGAGCAAAGCGGCGGCGTGCCGCTGATGTGGCAGACTG
+GCCATTCGCTGGTGAAGGCCAAGCTGGCCGAGACCGGCGCGCCGCTGGCCGGCGAGATGAGCGGCCATAT
+CTTCTTCAAGGAGCGCTGGTACGGCTTCGACGACGGCCTGTACACCGGCGCCCGCCTGCTGGAAATCGTC
+TCCCGCGAAACCGATGCGTCGCGCCCGCTGGAGGCCCTGCCGCAGGCGCTGTCGACCCCCGAGCTCAAGC
+TGGAGATGGCCGAGGGCGAGCCGCATGCGCTGATCGCCGCCCTGCAGCAGCAGGGCGAGTTCGCCAGCGC
+CAGCCGGCTGGTTACGATAGACGGCGTGCGCGCGGAATACCCGGACGGCTTCGGGCTGGCGCGCGCCTCC
+AATACCACCCCCGTCGTCGTGCTGCGCTTCGAAGCGGAGACCGAGCCGGGCCTGGCCCGCATCCAGCAGG
+AATTCCGCCAGCAGCTGCTGCGGCTGGCTCCGCAAGCCAAACTGCCCTTCTGA
+>lcl|CP011448.1_cds_ALH77215.1_1866 [gene=tyrB] [locus_tag=B3921_2112] [protein=aromatic amino acid aminotransferase] [protein_id=ALH77215.1] [location=2216606..2217808] [gbkey=CDS]
+ATGAGCACTCTTTTCGCTTCCGTCGAACTCGCGCCGCGCGACCCCATTCTTGGCCTGAACGAACAGTACA
+ACGCCGATACCCGTCCCGGCAAAGTGAACCTGGGCGTGGGCGTGTACTACGACGACGAAGGCCGCATCCC
+GCTGCTTCAGGCCGTGCGCAAGGCCGAGGTGGCCCGCATCGAAGCCGCCGCCGCCCGCGGCTATCTGCCG
+ATCGAAGGCATCGCGGGGTACAACAAGGGTGCGCAGGCGCTGCTGCTGGGCGCCGACTCGCCGCTGGCCG
+CCGAAGGCCGCGTGCTGACCGCGCAGGCCCTGGGCGGCACCGGCGCGCTGAAGATCGGCGCCGACTTCCT
+GCGCCAGCTGCTGCCGCAGTCCAAGGTCCTCATCAGCGACCCCAGCTGGGAAAACCACCGCGCCCTGTTC
+GAGCGCGCCGGCTTCCCGGTCGAGACCTACGCTTATTACGATGCCGCCACCCATGGCCTGAACTTCGAAG
+CCATGCTGGCCGCCCTGCAGGCCGCGCCCGAACAGACCATCGTGGTGCTGCACGCCTGCTGCCACAACCC
+GACCGGCGTCGATCCCACGCCGCAACAGTGGGAACAGATCGCCGCCGTGGTCAAGGCGCGCAACCTGGTG
+CCGTTCCTCGACATCGCCTACCAGGGCTTCGGCGAAGGCCTGGAGCAGGACGCCGCCGTGGTGCGCATGT
+TCGCCGAGCTCGACCTGACCATGTTCATCAGCTCGTCGTTCTCCAAGTCCTTCTCGCTGTATGGCGAGCG
+GGTCGGGGCCCTGACCGTGGTGGCCGGCAGCAAGGACGAGGCCGCCCGCGTGCTCAGCCAGCTCAAGCGC
+GTGATCCGCACCAACTACTCCAACCCGCCCACCCACGGCGGCACCGTGGTGTCCACGGTCCTGAACACAC
+CCGAGCTGTTCGCGCTCTGGGAAAATGAACTGGCCGGCATGCGCGACCGCATCCGCCTGATGCGCAAGGA
+GCTGGTCGAGAAGATCAAGACCCAGGGCGTGGCGCAGGACTTCAGCTTCGTGCTGGCGCAGCGCGGCATG
+TTCTCGTACTCGGGCCTGACCGCCGCCCAGGTCGATCGCCTGCGCGAAGAGCACGGCATCTACGCGGTCT
+CCAGCGGCCGCATCTGCGTGGCCGCGCTCAACAGCCGCAACATCGACGCGGTCGCGGCCGGCATCGCCGC
+GGTGCTGAAGTAG

tests/resources/tohama_I_bpertussis_adk.fasta

@@ -0,0 +1,11 @@
+>lcl|BX640419.1_cds_CAE43044.1_2724 [gene=adK] [locus_tag=BP2769] [db_xref=GOA:P0DKX8,InterPro:IPR000850,InterPro:IPR006259,InterPro:IPR007862,InterPro:IPR027417] [protein=adenylate kinase] [protein_id=CAE43044.1] [location=164032..164688] [gbkey=CDS]
+ATGCGTCTCATTCTGCTCGGACCGCCCGGAGCCGGCAAAGGCACCCAAGCCGCCTTTCTCACCCAACACT
+ACGGCATCCCGCAGATATCCACCGGTGACATGCTGCGCGCCGCCGTCAAGGCCGGCACGCCGCTGGGCCT
+GGAAGCCAAGAAGGTCATGGACGCGGGCGGCCTGGTCTCGGACGACCTGATCATCGGCCTGGTGCGCGAT
+CGCCTGACCCAGCCCGATTGCGCCAACGGCTACCTGTTCGACGGTTTCCCGCGCACCATCCCGCAGGCCG
+ACGCGCTCAAGAGCGCCGGCATCGCGCTGGATTACGTGGTCGAGATCGAAGTGCCGGAAAGCGACATCAT
+CGAACGCATGAGCGAACGCCGCGTGCACCCGGCCAGCGGCCGCAGCTACCACGTACGCTTCAATCCGCCC
+AAGGCCGAAGGCGTGGACGACGTCACGGGCGAACCGCTGGTGCAGCGCGACGACGACCGCGAGGAAACCG
+TGCGCCATCGTCTCAACGTCTACCAGAACCAGACCCGCCCGCTGGTCGACTACTACTCGTCCTGGGCCCA
+GTCCGATGCCGCCGCGGCGCCCAAGTACCGCAAGATCTCCGGCGTCGGCTCGGTCGACGAAATCAAGAGC
+CGCCTGTCGCAGGCTCTGCAGAGCTAA