Merge branch 'features/improved-oop-architecture' into features/non-exact-notation

This commit is contained in:
2025-02-12 17:53:25 +00:00
7 changed files with 56008 additions and 50909 deletions

View File

@@ -1,6 +1,6 @@
# autoBIGS.Engine
A python library implementing common BIGSdb MLST schemes and databases. Implementation follows the RESTful API outlined by the official [BIGSdb documentation](https://bigsdb.readthedocs.io/en/latest/rest.html) up to `V1.50.0`.
A python library implementing common BIGSdb MLST schemes and databases accesses for the purpose of typing sequences automatically. Implementation follows the RESTful API outlined by the official [BIGSdb documentation](https://bigsdb.readthedocs.io/en/latest/rest.html) up to `V1.50.0`.
## Features

View File

@@ -50,17 +50,17 @@ bpertussis_tohamaI_bad_profile = MLSTProfile((
Allele("pgm", "5", None),
), "unknown", "unknown")
hinfluenzae_fdaargos_profile = MLSTProfile((
Allele("adk", "1", None),
Allele("atpG", "1", None),
Allele("frdB", "1", None),
Allele("fucK", "1", None),
Allele("mdh", "1", None),
Allele("pgi", "1", None),
Allele("recA", "5", None)
), "3", "ST-3 complex")
hinfluenzae_2014_102_profile = MLSTProfile((
Allele("adk", "28", None),
Allele("atpG", "33", None),
Allele("frdB", "7", None),
Allele("fucK", "18", None),
Allele("mdh", "11", None),
Allele("pgi", "125", None),
Allele("recA", "89", None)
), "478", "unknown")
hinfluenzae_fdaargos_bad_profile = MLSTProfile((
hinfluenzae_2014_102_bad_profile = MLSTProfile((
Allele("adk", "3", None),
Allele("atpG", "121", None),
Allele("frdB", "6", None),
@@ -68,15 +68,12 @@ hinfluenzae_fdaargos_bad_profile = MLSTProfile((
Allele("mdh", "12", None),
Allele("pgi", "4", None),
Allele("recA", "5", None)
), "3", "ST-3 complex")
), "unknown", "unknown")
hinfluenzae_fdaargos_sequence = str(SeqIO.read("tests/resources/fdaargos_1560_hinfluenza.fasta", "fasta").seq)
hinfluenzae_fdaargos_fragmented_sequence = tuple(SeqIO.parse("tests/resources/tohama_I_bpertussis_features.fasta", "fasta"))
@pytest.mark.parametrize("local_db,database_api,database_name,schema_id,seq_path,feature_seqs_path,expected_profile,bad_profile", [
(False, "https://bigsdb.pasteur.fr/api", "pubmlst_bordetella_seqdef", 3, "tohama_I_bpertussis.fasta", "tohama_I_bpertussis_features.fasta", bpertussis_tohamaI_profile, bpertussis_tohamaI_bad_profile),
(False, "https://rest.pubmlst.org", "pubmlst_hinfluenzae_seqdef", 1, "fdaargos_1560_hinfluenza.fasta", "fdaargos_1560_hinfluenza_features.fasta", hinfluenzae_fdaargos_profile, hinfluenzae_fdaargos_bad_profile),
(False, "https://rest.pubmlst.org", "pubmlst_hinfluenzae_seqdef", 1, "2014-102_hinfluenza.fasta", "2014-102_hinfluenza_features.fasta", hinfluenzae_2014_102_profile, hinfluenzae_2014_102_bad_profile),
])
class TestBIGSdbMLSTProfiler:
async def test_profiling_results_in_exact_matches_when_exact(self, local_db, database_api, database_name, schema_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
@@ -202,7 +199,6 @@ class TestBIGSdbIndex:
assert databases["pubmlst_bordetella_seqdef"] == "https://bigsdb.pasteur.fr/api"
@pytest.mark.parametrize("local", [
(True),
(False)
])
async def test_bigsdb_index_instantiates_correct_profiler(self, local):

File diff suppressed because it is too large Load Diff

File diff suppressed because it is too large Load Diff

File diff suppressed because it is too large Load Diff

View File

@@ -1,11 +0,0 @@
>lcl|CP085952.1_gene_371 [gene=adk] [locus_tag=LK401_01855] [location=complement(365128..365772)] [gbkey=Gene]
ATGAAAATTATTCTTTTAGGTGCACCGGGTGCAGGTAAAGGCACTCAAGCACAATTTATTATGAACAAAT
TTGGTATCCCGCAAATTTCAACTGGTGATATGTTCCGTGCTGCAATCAAAGCGGGGACTGAACTTGGCAA
ACAAGCTAAAGCATTAATGGATGAAGGTAAATTAGTGCCAGATGAATTAACCGTTGCCCTTGTAAAAGAT
CGTATTGCTCAAGCTGACTGCACAAATGGTTTCTTGTTAGATGGTTTCCCTCGTACTATTCCACAAGCGG
ATGCACTGAAAGATTCAGGTGTTAAAATTGACTTTGTTTTAGAATTTGATGTGCCAGACGAAGTGATTGT
TGAACGTATGAGTGGCCGTCGCGTACACCAAGCGTCTGGCCGTTCTTACCACATCGTTTATAATCCACCA
AAAGTGGAAGGTAAAGATGATGTAACAGGCGAAGATTTAATTATTCGTGCAGACGATAAACCAGAAACTG
TATTAGATCGTTTAGCCGTATATCATAAACAAACTAGCCCATTAATTGATTATTACCAAGCAGAAGCGAA
AGCGGGGAATACTCAATATTTCCGTTTAGACGGTACACAAAAAGTAGAAGAAGTTAGCCAAGAGTTAGAT
AAAATCTTAGGCTAA

File diff suppressed because it is too large Load Diff