57 Commits

Author SHA1 Message Date
6cdc4ff4ae Merge branch 'develop'
Some checks reported errors
autoBIGS.engine/pipeline/tag Something is wrong with the build of this commit
autoBIGS.engine/pipeline/head This commit looks good
2025-02-26 05:26:12 +00:00
4b34036d17 Fixed concurrent profile_multiple_strings implementation
All checks were successful
autoBIGS.engine/pipeline/head This commit looks good
2025-02-26 05:16:24 +00:00
27ae89fde7 Replaced schema with scheme
All checks were successful
autoBIGS.engine/pipeline/head This commit looks good
2025-02-26 04:50:54 +00:00
06dbb56c28 Revert "Recipe meta.yaml also archived as artifact"
All checks were successful
autoBIGS.engine/pipeline/head This commit looks good
This reverts commit 79fcce8b84.
2025-02-21 06:34:59 +00:00
79fcce8b84 Recipe meta.yaml also archived as artifact
Some checks reported errors
autoBIGS.engine/pipeline/head Something is wrong with the build of this commit
2025-02-21 06:22:27 +00:00
f4064f087e Fixed typos in pipeline script
All checks were successful
autoBIGS.engine/pipeline/head This commit looks good
2025-02-21 06:12:35 +00:00
276665f5fd Added curl to environment requirements
All checks were successful
autoBIGS.engine/pipeline/head This commit looks good
2025-02-21 06:01:39 +00:00
fd536862e2 Twine version specified to 6.0.1 to avoid Twine issue 15611
Some checks failed
autoBIGS.engine/pipeline/head There was a failure building this commit
2025-02-21 05:53:08 +00:00
576dc303f4 Changed requested kubernetes container to be miniforge 2025-02-21 05:52:34 +00:00
2822a483e3 Initial attempt at switching to a conda based build environment
Some checks failed
autoBIGS.engine/pipeline/head There was a failure building this commit
2025-02-21 05:37:56 +00:00
b8cebb8ba4 Infrastructure for concurrent processing implemented
All checks were successful
autoBIGS.engine/pipeline/head This commit looks good
2025-02-19 15:49:46 +00:00
62ce1c9b2f Updated README.md to explain versioning
All checks were successful
automlst.engine/pipeline/head This commit looks good
2025-02-18 16:32:02 +00:00
7384895578 Writing now uses named MLST profile
All checks were successful
automlst.engine/pipeline/head This commit looks good
automlst.engine/pipeline/tag This commit looks good
2025-02-18 16:03:17 +00:00
5a03c7e8d8 Multiple string profiling now respects grouped queries (for non-WGS)
All checks were successful
automlst.engine/pipeline/head This commit looks good
2025-02-18 15:34:18 +00:00
ddf9cde175 Added a license text to pyproject.toml 2025-02-14 20:47:06 +00:00
2e8cdd8da9 Updated URL links
All checks were successful
automlst.engine/pipeline/head This commit looks good
autoBIGS.engine/pipeline/tag This commit looks good
2025-02-14 20:37:13 +00:00
d0318536b2 Changed FASTA reading to group based on file for merging partial targets 2025-02-14 14:35:53 +00:00
765cf9d418 Merge branch 'features/improved-oop-architecture' into features/non-exact-notation 2025-02-12 17:53:25 +00:00
348c3d00b4 Updated README.md to be more clear 2025-02-12 17:52:53 +00:00
1c3f7f9ed8 Removed test for instantiating local MLST profiler 2025-02-12 17:46:55 +00:00
e4ddaf2e8c Changed to a MLST typable sequence for pubMLST tests 2025-02-12 17:43:26 +00:00
73aade2bde Merge branch 'features/improved-oop-architecture' into features/non-exact-notation 2025-02-12 17:07:51 +00:00
af8590baa7 Removed import of deleted feature 2025-02-12 17:07:10 +00:00
36bca1b70d Merge branch 'features/improved-oop-architecture' into features/non-exact-notation 2025-02-12 17:02:22 +00:00
09a693b696 Removed features being worked on in separate branch 2025-02-12 17:02:00 +00:00
f76bf86ef6 Fixed bad profile for H. influenzae non-exact test case 2025-02-12 16:59:50 +00:00
a60daf3ee2 Updated H. influenzae database API url 2025-02-12 16:39:13 +00:00
fbfd993269 Copied tests over from CSV tests and updated to reflect current code base 2025-02-12 16:36:59 +00:00
ba606c35a9 conversion of collection of alleles to map now produces results with tuples instead of lists 2025-02-12 16:36:31 +00:00
4183840ba0 Added notation to indicate inexact matching in CSV 2025-02-12 15:59:19 +00:00
7fb3eab5b6 Added pubMLST test case to bigsdb tests and updated to reflect codebase changes 2025-02-12 15:53:14 +00:00
175a51f968 Replaced local profiler with a not implemented exception 2025-02-12 15:52:48 +00:00
897f7ee922 Merge branch 'develop' into features/local-typing
Some checks reported errors
automlst.engine/pipeline/head Something is wrong with the build of this commit
2025-02-12 15:01:12 +00:00
bfc286e6b0 Updated test cases to reflect changes in codebase
MLSTProfile will always return a value, even if there were no exact matches.

Removed a test case specifically testing for stopping on failure, which is a removed feature.
2025-02-12 14:57:51 +00:00
a88225fcff Added check to wrap string into list to prevent decomposing string for querying 2025-02-12 14:46:29 +00:00
c18d817cd9 Added test to verify that CSV target columns are ordered 2025-02-12 14:38:12 +00:00
f462e6d5e0 Moved "LazyPersistentCachedBIGSdbMLSTProfiler" to separate branch and deleted from current branch 2025-02-11 19:24:23 +00:00
e568e9fb2c Adapted latest merged reading codebase to current codebase 2025-02-11 19:13:29 +00:00
4b9eb8674d Merge branch 'develop' into features/local-typing 2025-02-11 17:55:34 +00:00
f75707e4fe CSV output column order is now predictable (sorted) 2025-02-11 17:54:48 +00:00
b4845fab34 Added automatic handling of strings instead of arrays of sequences to typing 2025-02-06 21:15:50 +00:00
fe999f1cab Added a unit test for multithreaded alignments 2025-02-06 18:01:50 +00:00
85946eb110 Fixed match metric difference between remote and local 2025-02-06 17:12:31 +00:00
a27e09da31 Added code to retrieve sequences and annotations from NCBI GenBank 2025-02-06 17:11:20 +00:00
ba2b688e89 Removed sorting as it seems unecessary 2025-02-05 22:06:50 +00:00
49f31b7943 Async aligner work tracking issue fixed 2025-02-05 21:47:51 +00:00
1c6e1cfb35 Fixed issue with hashing a ndarray by using tuple. 2025-02-05 20:43:53 +00:00
fb99526162 Updated iteration on asynchronous aligner 2025-02-05 17:17:37 +00:00
ff8a1aff08 Implemented annotated local typing method without testing 2025-02-04 16:19:00 +00:00
341ca933a3 Fixed typo in CI script 2025-01-29 17:00:25 +00:00
3e3898334f Began implementing LazyPersistentCachedBIGSdbMLSTProfiler 2025-01-27 22:03:49 +00:00
ba1f0aa318 Fixed potential memory leak 2025-01-27 22:02:52 +00:00
6d0157581f Removed conda environment step for now 2025-01-24 21:43:55 +00:00
4bcbfa0c6a Began adding conda steps for automatic PRs to Bioconda 2025-01-24 19:33:27 +00:00
ca0f9673b0 Upgraded Python version requirement due to use of f-strings 2025-01-24 17:00:57 +00:00
5048fa8057 Deleted uneeded file 2025-01-23 19:23:56 +00:00
39125c848e Added a wildcard patch specifier for aiohttp 2025-01-23 19:23:42 +00:00
39 changed files with 56852 additions and 24369 deletions

11
.devcontainer/Dockerfile Normal file
View File

@@ -0,0 +1,11 @@
FROM mcr.microsoft.com/devcontainers/anaconda:1-3
# Copy environment.yml (if found) to a temp location so we update the environment. Also
# copy "noop.txt" so the COPY instruction does not fail if no environment.yml exists.
COPY environment.yml* .devcontainer/noop.txt /tmp/conda-tmp/
RUN if [ -f "/tmp/conda-tmp/environment.yml" ]; then umask 0002 && /opt/conda/bin/conda env update -n base -f /tmp/conda-tmp/environment.yml; fi \
&& rm -rf /tmp/conda-tmp
# [Optional] Uncomment this section to install additional OS packages.
# RUN apt-get update && export DEBIAN_FRONTEND=noninteractive \
# && apt-get -y install --no-install-recommends <your-package-list-here>

View File

@@ -1,9 +1,11 @@
// For format details, see https://aka.ms/devcontainer.json. For config options, see the
// README at: https://github.com/devcontainers/templates/tree/main/src/python
// README at: https://github.com/devcontainers/templates/tree/main/src/anaconda
{
"name": "Python 3",
// Or use a Dockerfile or Docker Compose file. More info: https://containers.dev/guide/dockerfile
"image": "mcr.microsoft.com/devcontainers/python:1-3.12-bullseye",
"name": "Anaconda (Python 3)",
"build": {
"context": "..",
"dockerfile": "Dockerfile"
}
// Features to add to the dev container. More info: https://containers.dev/features.
// "features": {},
@@ -12,14 +14,7 @@
// "forwardPorts": [],
// Use 'postCreateCommand' to run commands after the container is created.
"postCreateCommand": "pip3 install --user -r requirements.txt",
"customizations": {
"vscode": {
"extensions": [
"mechatroner.rainbow-csv"
]
}
}
// "postCreateCommand": "python --version",
// Configure tool-specific properties.
// "customizations": {},

3
.devcontainer/noop.txt Normal file
View File

@@ -0,0 +1,3 @@
This file copied into the container along with environment.yml* from the parent
folder. This file is included to prevents the Dockerfile COPY instruction from
failing if no environment.yml is found.

159
.gitignore vendored
View File

@@ -1,6 +1,6 @@
# File created using '.gitignore Generator' for Visual Studio Code: https://bit.ly/vscode-gig
# Created by https://www.toptal.com/developers/gitignore/api/visualstudiocode,svelte,python,linux,node
# Edit at https://www.toptal.com/developers/gitignore?templates=visualstudiocode,svelte,python,linux,node
# Created by https://www.toptal.com/developers/gitignore/api/visualstudiocode,linux,python
# Edit at https://www.toptal.com/developers/gitignore?templates=visualstudiocode,linux,python
### Linux ###
*~
@@ -17,146 +17,6 @@
# .nfs files are created when an open file is removed but is still being accessed
.nfs*
### Node ###
# Logs
logs
*.log
npm-debug.log*
yarn-debug.log*
yarn-error.log*
lerna-debug.log*
.pnpm-debug.log*
# Diagnostic reports (https://nodejs.org/api/report.html)
report.[0-9]*.[0-9]*.[0-9]*.[0-9]*.json
# Runtime data
pids
*.pid
*.seed
*.pid.lock
# Directory for instrumented libs generated by jscoverage/JSCover
lib-cov
# Coverage directory used by tools like istanbul
coverage
*.lcov
# nyc test coverage
.nyc_output
# Grunt intermediate storage (https://gruntjs.com/creating-plugins#storing-task-files)
.grunt
# Bower dependency directory (https://bower.io/)
bower_components
# node-waf configuration
.lock-wscript
# Compiled binary addons (https://nodejs.org/api/addons.html)
build/Release
# Dependency directories
node_modules/
jspm_packages/
# Snowpack dependency directory (https://snowpack.dev/)
web_modules/
# TypeScript cache
*.tsbuildinfo
# Optional npm cache directory
.npm
# Optional eslint cache
.eslintcache
# Optional stylelint cache
.stylelintcache
# Microbundle cache
.rpt2_cache/
.rts2_cache_cjs/
.rts2_cache_es/
.rts2_cache_umd/
# Optional REPL history
.node_repl_history
# Output of 'npm pack'
*.tgz
# Yarn Integrity file
.yarn-integrity
# dotenv environment variable files
.env
.env.development.local
.env.test.local
.env.production.local
.env.local
# parcel-bundler cache (https://parceljs.org/)
.cache
.parcel-cache
# Next.js build output
.next
out
# Nuxt.js build / generate output
.nuxt
dist
# Gatsby files
.cache/
# Comment in the public line in if your project uses Gatsby and not Next.js
# https://nextjs.org/blog/next-9-1#public-directory-support
# public
# vuepress build output
.vuepress/dist
# vuepress v2.x temp and cache directory
.temp
# Docusaurus cache and generated files
.docusaurus
# Serverless directories
.serverless/
# FuseBox cache
.fusebox/
# DynamoDB Local files
.dynamodb/
# TernJS port file
.tern-port
# Stores VSCode versions used for testing VSCode extensions
.vscode-test
# yarn v2
.yarn/cache
.yarn/unplugged
.yarn/build-state.yml
.yarn/install-state.gz
.pnp.*
### Node Patch ###
# Serverless Webpack directories
.webpack/
# Optional stylelint cache
# SvelteKit build / generate output
.svelte-kit
### Python ###
# Byte-compiled / optimized / DLL files
__pycache__/
@@ -202,6 +62,7 @@ htmlcov/
.nox/
.coverage
.coverage.*
.cache
nosetests.xml
coverage.xml
*.cover
@@ -215,6 +76,7 @@ cover/
*.pot
# Django stuff:
*.log
local_settings.py
db.sqlite3
db.sqlite3-journal
@@ -278,6 +140,7 @@ celerybeat.pid
*.sage.py
# Environments
.env
.venv
env/
venv/
@@ -326,13 +189,6 @@ poetry.toml
# LSP config files
pyrightconfig.json
### Svelte ###
# gitignore template for the SvelteKit, frontend web component framework
# website: https://kit.svelte.dev/
.svelte-kit/
package
### VisualStudioCode ###
.vscode/*
!.vscode/settings.json
@@ -352,9 +208,8 @@ package
.history
.ionide
# End of https://www.toptal.com/developers/gitignore/api/visualstudiocode,svelte,python,linux,node
# End of https://www.toptal.com/developers/gitignore/api/visualstudiocode,linux,python
# Custom rules (everything added below won't be overriden by 'Generate .gitignore File' if you use 'Update' option)
output
*.private.*
conda-bld

5
.vscode/extensions.json vendored Normal file
View File

@@ -0,0 +1,5 @@
{
"recommendations": [
"piotrpalarz.vscode-gitignore-generator"
]
}

25
.vscode/launch.json vendored
View File

@@ -1,25 +0,0 @@
{
// Use IntelliSense to learn about possible attributes.
// Hover to view descriptions of existing attributes.
// For more information, visit: https://go.microsoft.com/fwlink/?linkid=830387
"version": "0.2.0",
"configurations": [
{
"name": "autobigs info -lschema pubmlst_bordetella_seqdef",
"type": "debugpy",
"request": "launch",
"program": "${workspaceFolder}/src/autobigs/cli/program.py",
"console": "integratedTerminal",
"args": [
"info",
"-lschemas",
"pubmlst_bordetella_seqdef"
],
"cwd": "${workspaceFolder}/src",
"env": {
"PYTHONPATH": "${workspaceFolder}/src"
}
}
]
}

14
Jenkinsfile vendored
View File

@@ -2,14 +2,14 @@ pipeline {
agent {
kubernetes {
cloud 'rsys-devel'
defaultContainer 'pip'
inheritFrom 'pip'
defaultContainer 'miniforge3'
inheritFrom 'miniforge'
}
}
stages {
stage("install") {
steps {
sh 'python -m pip install -r requirements.txt'
sh 'conda env update -n base -f environment.yml'
}
}
stage("unit tests") {
@@ -22,11 +22,14 @@ pipeline {
stage("build") {
steps {
sh "python -m build"
sh "grayskull pypi dist/*.tar.gz --maintainers 'Harrison Deng'"
sh "python scripts/patch_recipe.py"
sh 'conda build autobigs-engine -c bioconda --output-folder conda-bld --verify'
}
}
stage("archive") {
steps {
archiveArtifacts artifacts: 'dist/*.tar.gz, dist/*.whl', fingerprint: true, followSymlinks: false, onlyIfSuccessful: true
archiveArtifacts artifacts: 'dist/*.tar.gz, dist/*.whl, conda-bld/**/*.conda', fingerprint: true, followSymlinks: false, onlyIfSuccessful: true
}
}
stage("publish") {
@@ -36,7 +39,8 @@ pipeline {
CREDS = credentials('username-password-rs-git')
}
steps {
sh returnStatus: true, script: 'python -m twine upload --repository-url https://git.reslate.systems/api/packages/ydeng/pypi -u ${CREDS_USR} -p ${CREDS_PSW} --non-interactive --disable-progress-bar --verbose dist/*'
sh 'python -m twine upload --repository-url https://git.reslate.systems/api/packages/ydeng/pypi -u ${CREDS_USR} -p ${CREDS_PSW} --non-interactive --disable-progress-bar --verbose dist/*'
sh 'curl --user ${CREDS_USR}:${CREDS_PSW} --upload-file conda-bld/**/*.conda https://git.reslate.systems/api/packages/${CREDS_USR}/conda/$(basename conda-bld/**/*.conda)'
}
}
stage ("pypi.org") {

View File

@@ -1,13 +1,14 @@
# autoBIGS.Engine
# autoBIGS.engine
A python library implementing common BIGSdb MLST schemes and databases accesses for the purpose of typing sequences automatically. Implementation follows the RESTful API outlined by the official [BIGSdb documentation](https://bigsdb.readthedocs.io/en/latest/rest.html) up to `V1.50.0`.
A python library implementing common BIGSdb MLST schemes and databases. Implementation follows the RESTful API outlined by the official [BIGSdb documentation](https://bigsdb.readthedocs.io/en/latest/rest.html) up to `V1.50.0`.
## Features
Briefly, this library can:
- Import multiple `FASTA` files
- Fetch the available BIGSdb databases that is currently live and available
- Fetch the available BIGSdb database schemas for a given MLST database
- Fetch the available BIGSdb database schemes for a given MLST database
- Retrieve exact/non-exact MLST allele variant IDs based off a sequence
- Retrieve MLST sequence type IDs based off a sequence
- Output all results to a single CSV
@@ -23,3 +24,15 @@ Then, it's as easy as running `pip install autobigs-engine` in any terminal that
### CLI usage
This is a independent python library and thus does not have any form of direct user interface. One way of using it could be to create your own Python script that makes calls to this libraries functions. Alternatively, you may use `autobigs-cli`, a `Python` package that implements a CLI for calling this library.
## Versioning
the autoBIGS project follows [semantic versioning](https://semver.org/) where the three numbers may be interpreted as MAJOR.MINOR.PATCH.
Note regarding major version 0 ([spec item 4](https://semver.org/#spec-item-4)), the following adaptation of semantic versioning definition is as follows:
1. Given x.Y.z, Y is only incremented when a backwards incompatible change is made.
2. Given x.y.Z, Z is only incremented when a backwards compatible change is made.
Versions of autoBIGS items with a major version number of 0 will introduce numerous changes and patches. As such, changes between such versions should be considered highly variable.

44
autobigs-engine/meta.yaml Normal file
View File

@@ -0,0 +1,44 @@
{% set name = "autoBIGS.engine" %}
{% set version = "0.12.1.dev1+gb8cebb8.d20250221" %}
package:
name: {{ name|lower|replace(".", "-") }}
version: {{ version }}
source:
url: file:///workspaces/autoBIGS.engine/dist/autobigs_engine-0.12.1.dev1%2Bgb8cebb8.d20250221.tar.gz
sha256: c86441b94f935cfa414ff28ca4c026a070e0fb15988ea3bb7d1a942859a09b16
build:
noarch: python
script: {{ PYTHON }} -m pip install . -vv --no-deps --no-build-isolation
number: 0
run_exports:
- {{ pin_subpackage( name|lower|replace(".", "-"), max_pin="x.x") }}
requirements:
host:
- python >=3.12
- setuptools >=64
- setuptools-scm >=8
- pip
run:
- python >=3.12
- biopython ==1.85
- aiohttp ==3.11.*
test:
imports:
- autobigs
commands:
- pip check
requires:
- pip
about:
summary: A library to rapidly fetch fetch MLST profiles given sequences for various diseases.
license: GPL-3.0-or-later
license_file: LICENSE
home: https://github.com/Syph-and-VPD-Lab/autoBIGS.engine
extra:
recipe-maintainers:
- Harrison Deng

16
environment.yml Normal file
View File

@@ -0,0 +1,16 @@
name: ci
channels:
- bioconda
- conda-forge
dependencies:
- aiohttp==3.11.*
- biopython==1.85
- pytest
- pytest-asyncio
- python-build
- conda-build
- twine==6.0.1
- setuptools_scm
- pytest-cov
- grayskull
- curl

View File

@@ -9,14 +9,16 @@ readme = "README.md"
dependencies = [
"biopython==1.85",
"aiohttp[speedups]==3.11",
"aiohttp[speedups]==3.11.*",
]
requires-python = ">=3.11"
requires-python = ">=3.12"
description = "A library to rapidly fetch fetch MLST profiles given sequences for various diseases."
license = {text = "GPL-3.0-or-later"}
[project.urls]
Repository = "https://github.com/RealYHD/autoBIGS.engine"
Issues = "https://github.com/RealYHD/autoBIGS.engine/issues"
Homepage = "https://github.com/Syph-and-VPD-Lab/autoBIGS.engine"
Source = "https://github.com/Syph-and-VPD-Lab/autoBIGS.engine"
Issues = "https://github.com/Syph-and-VPD-Lab/autoBIGS.engine/issues"
[tool.setuptools_scm]

View File

@@ -1,8 +0,0 @@
aiohttp[speedups]==3.11
biopython==1.85
pytest
pytest-asyncio
build
twine
setuptools_scm
pytest-cov

103
scripts/patch_recipe.py Normal file
View File

@@ -0,0 +1,103 @@
#!/usr/bin/env python3
import argparse
from os import fdopen, path
import os
import re
import shutil
from sys import argv
import tempfile
INDENTATION = " "
GRAYSKULL_OUTPUT_PATH = "autoBIGS.engine"
RUN_EXPORTED_VALUE = r'{{ pin_subpackage( name|lower|replace(".", "-"), max_pin="x.x") }}'
LICENSE_SUFFIX = "-or-later"
HOME_PAGE = "https://github.com/Syph-and-VPD-Lab/autoBIGS.engine"
def _calc_indentation(line: str):
return len(re.findall(INDENTATION, line.split(line.strip())[0])) if line != "\n" else 0
def read_grayskull_output():
original_recipe = path.abspath(GRAYSKULL_OUTPUT_PATH)
original_meta = path.join(original_recipe, "meta.yaml")
meta_file = open(original_meta)
lines = meta_file.readlines()
meta_file.close()
return lines
def update_naming_scheme(lines):
modified_lines = []
for line in lines:
matches = re.finditer(r"\{\{\s*name\|lower()\s+\}\}", line)
modified_line = line
for match in matches:
modified_line = modified_line[:match.start(1)] + r'|replace(".", "-")' + modified_line[match.end(1):]
modified_lines.append(modified_line)
return modified_lines
def inject_run_exports(lines: list[str]):
package_indent = False
modified_lines = []
for line in lines:
indentation_count = _calc_indentation(line)
if line == "build:\n" and indentation_count == 0:
package_indent = True
modified_lines.append(line)
elif package_indent and indentation_count == 0:
modified_lines.append(INDENTATION*1 + "run_exports:\n")
modified_lines.append(INDENTATION*2 + "- " + RUN_EXPORTED_VALUE + "\n")
package_indent = False
else:
modified_lines.append(line)
return modified_lines
def suffix_license(lines: list[str]):
about_indent = False
modified_lines = []
for line in lines:
indentation_count = _calc_indentation(line)
if line == "about:\n" and indentation_count == 0:
about_indent = True
modified_lines.append(line)
elif about_indent and indentation_count == 1 and line.lstrip().startswith("license:"):
modified_lines.append(line.rstrip() + LICENSE_SUFFIX + "\n")
about_indent = False
else:
modified_lines.append(line)
return modified_lines
def inject_home_page(lines: list[str]):
about_indent = False
modified_lines = []
for line in lines:
indentation_count = _calc_indentation(line)
if line == "about:\n" and indentation_count == 0:
about_indent = True
modified_lines.append(line)
elif about_indent and indentation_count == 0:
modified_lines.append(INDENTATION + "home: " + HOME_PAGE + "\n")
about_indent = False
else:
modified_lines.append(line)
return modified_lines
def write_to_original(lines: list[str]):
original_recipe = path.abspath(GRAYSKULL_OUTPUT_PATH)
original_meta = path.join(original_recipe, "meta.yaml")
with open(original_meta, "w") as file:
file.writelines(lines)
def rename_recipe_dir():
new_recipe_name = path.abspath(path.join(GRAYSKULL_OUTPUT_PATH.replace(".", "-").lower()))
shutil.rmtree(new_recipe_name, ignore_errors=True)
os.replace(path.abspath(GRAYSKULL_OUTPUT_PATH), new_recipe_name)
if __name__ == "__main__":
original_grayskull_out = read_grayskull_output()
modified_recipe_meta = None
modified_recipe_meta = update_naming_scheme(original_grayskull_out)
modified_recipe_meta = inject_run_exports(modified_recipe_meta)
modified_recipe_meta = suffix_license(modified_recipe_meta)
modified_recipe_meta = inject_home_page(modified_recipe_meta)
write_to_original(modified_recipe_meta)
rename_recipe_dir()

View File

@@ -0,0 +1,224 @@
from abc import abstractmethod
import asyncio
from collections import defaultdict
from contextlib import AbstractAsyncContextManager
import csv
from os import path
import os
import shutil
import tempfile
from typing import Any, AsyncGenerator, AsyncIterable, Coroutine, Iterable, Mapping, Sequence, Set, Union
from aiohttp import ClientSession, ClientTimeout
from autobigs.engine.reading import read_fasta
from autobigs.engine.structures.alignment import PairwiseAlignment
from autobigs.engine.structures.genomics import NamedString
from autobigs.engine.structures.mlst import Allele, NamedMLSTProfile, AlignmentStats, MLSTProfile
from autobigs.engine.exceptions.database import NoBIGSdbExactMatchesException, NoBIGSdbMatchesException, NoSuchBIGSdbDatabaseException
from Bio.Align import PairwiseAligner
class BIGSdbMLSTProfiler(AbstractAsyncContextManager):
@abstractmethod
def determine_mlst_allele_variants(self, query_sequence_strings: Union[Iterable[Union[NamedString, str]], Union[NamedString, str]]) -> AsyncGenerator[Union[Allele, tuple[str, Allele]], Any]:
pass
@abstractmethod
async def determine_mlst_st(self, alleles: Union[AsyncIterable[Union[Allele, tuple[str, Allele]]], Iterable[Union[Allele, tuple[str, Allele]]]]) -> Union[MLSTProfile, NamedMLSTProfile]:
pass
@abstractmethod
async def profile_string(self, query_sequence_strings: Iterable[Union[NamedString, str]]) -> Union[NamedMLSTProfile, MLSTProfile]:
pass
@abstractmethod
def profile_multiple_strings(self, query_named_string_groups: AsyncIterable[Iterable[NamedString]], stop_on_fail: bool = False) -> AsyncGenerator[NamedMLSTProfile, Any]:
pass
@abstractmethod
async def close(self):
pass
class RemoteBIGSdbMLSTProfiler(BIGSdbMLSTProfiler):
def __init__(self, database_api: str, database_name: str, scheme_id: int):
self._database_name = database_name
self._scheme_id = scheme_id
self._base_url = f"{database_api}/db/{self._database_name}/schemes/{self._scheme_id}/"
self._http_client = ClientSession(self._base_url, timeout=ClientTimeout(60))
async def __aenter__(self):
return self
async def determine_mlst_allele_variants(self, query_sequence_strings: Union[Iterable[Union[NamedString, str]], Union[NamedString, str]]) -> AsyncGenerator[Union[Allele, tuple[str, Allele]], Any]:
# See https://bigsdb.pasteur.fr/api/db/pubmlst_bordetella_seqdef/schemes
uri_path = "sequence"
if isinstance(query_sequence_strings, str) or isinstance(query_sequence_strings, NamedString):
query_sequence_strings = [query_sequence_strings]
for sequence_string in query_sequence_strings:
async with self._http_client.post(uri_path, json={
"sequence": sequence_string if isinstance(sequence_string, str) else sequence_string.sequence,
"partial_matches": True
}) as response:
sequence_response: dict = await response.json()
if "exact_matches" in sequence_response:
# loci -> list of alleles with id and loci
exact_matches: dict[str, Sequence[dict[str, str]]] = sequence_response["exact_matches"]
for allele_loci, alleles in exact_matches.items():
for allele in alleles:
alelle_id = allele["allele_id"]
result_allele = Allele(allele_locus=allele_loci, allele_variant=alelle_id, partial_match_profile=None)
yield result_allele if isinstance(sequence_string, str) else (sequence_string.name, result_allele)
elif "partial_matches" in sequence_response:
partial_matches: dict[str, dict[str, Union[str, float, int]]] = sequence_response["partial_matches"]
for allele_loci, partial_match in partial_matches.items():
if len(partial_match) <= 0:
continue
partial_match_profile = AlignmentStats(
percent_identity=float(partial_match["identity"]),
mismatches=int(partial_match["mismatches"]),
gaps=int(partial_match["gaps"]),
match_metric=int(partial_match["bitscore"])
)
result_allele = Allele(
allele_locus=allele_loci,
allele_variant=str(partial_match["allele"]),
partial_match_profile=partial_match_profile
)
yield result_allele if isinstance(sequence_string, str) else (sequence_string.name, result_allele)
else:
raise NoBIGSdbMatchesException(self._database_name, self._scheme_id, sequence_string.name if isinstance(sequence_string, NamedString) else None)
async def determine_mlst_st(self, alleles: Union[AsyncIterable[Union[Allele, tuple[str, Allele]]], Iterable[Union[Allele, tuple[str, Allele]]]]) -> Union[MLSTProfile, NamedMLSTProfile]:
uri_path = "designations"
allele_request_dict: dict[str, list[dict[str, str]]] = defaultdict(list)
names_list = []
def insert_allele_to_request_dict(allele: Union[Allele, tuple[str, Allele]]):
if isinstance(allele, Allele):
allele_val = allele
else:
allele_val = allele[1]
names_list.append(allele[0])
allele_request_dict[allele_val.allele_locus].append({"allele": str(allele_val.allele_variant)})
if isinstance(alleles, AsyncIterable):
async for allele in alleles:
insert_allele_to_request_dict(allele)
else:
for allele in alleles:
insert_allele_to_request_dict(allele)
request_json = {
"designations": allele_request_dict
}
async with self._http_client.post(uri_path, json=request_json) as response:
response_json: dict = await response.json()
allele_set: Set[Allele] = set()
response_json.setdefault("fields", dict())
scheme_fields_returned: dict[str, str] = response_json["fields"]
scheme_fields_returned.setdefault("ST", "unknown")
scheme_fields_returned.setdefault("clonal_complex", "unknown")
scheme_exact_matches: dict = response_json["exact_matches"]
for exact_match_locus, exact_match_alleles in scheme_exact_matches.items():
allele_set.add(Allele(exact_match_locus, exact_match_alleles[0]["allele_id"], None))
if len(allele_set) == 0:
raise ValueError("Passed in no alleles.")
result_mlst_profile = MLSTProfile(allele_set, scheme_fields_returned["ST"], scheme_fields_returned["clonal_complex"])
if len(names_list) > 0:
result_mlst_profile = NamedMLSTProfile(str(tuple(names_list)), result_mlst_profile)
return result_mlst_profile
async def profile_string(self, query_sequence_strings: Iterable[Union[NamedString, str]]) -> Union[NamedMLSTProfile, MLSTProfile]:
alleles = self.determine_mlst_allele_variants(query_sequence_strings)
return await self.determine_mlst_st(alleles)
async def profile_multiple_strings(self, query_named_string_groups: AsyncIterable[Iterable[NamedString]], stop_on_fail: bool = False) -> AsyncGenerator[NamedMLSTProfile, Any]:
tasks: list[Coroutine[Any, Any, Union[NamedMLSTProfile, MLSTProfile]]] = []
async for named_strings in query_named_string_groups:
tasks.append(self.profile_string(named_strings))
for task in asyncio.as_completed(tasks):
named_mlst_profile = await task
try:
if isinstance(named_mlst_profile, NamedMLSTProfile):
yield named_mlst_profile
else:
raise TypeError("MLST profile is not named.")
except NoBIGSdbMatchesException as e:
if stop_on_fail:
raise e
causal_name = e.get_causal_query_name()
if causal_name is None:
raise ValueError("Missing query name despite requiring names.")
else:
yield NamedMLSTProfile(causal_name, None)
async def close(self):
await self._http_client.close()
async def __aexit__(self, exc_type, exc_value, traceback):
await self.close()
class BIGSdbIndex(AbstractAsyncContextManager):
KNOWN_BIGSDB_APIS = {
"https://bigsdb.pasteur.fr/api",
"https://rest.pubmlst.org"
}
def __init__(self):
self._http_client = ClientSession()
self._known_seqdef_dbs_origin: Union[Mapping[str, str], None] = None
self._seqdefdb_schemes: dict[str, Union[Mapping[str, int], None]] = dict()
super().__init__()
async def __aenter__(self):
return self
async def get_known_seqdef_dbs(self, force: bool = False) -> Mapping[str, str]:
if self._known_seqdef_dbs_origin is not None and not force:
return self._known_seqdef_dbs_origin
known_seqdef_dbs = dict()
for known_bigsdb in BIGSdbIndex.KNOWN_BIGSDB_APIS:
async with self._http_client.get(f"{known_bigsdb}/db") as response:
response_json_databases = await response.json()
for database_group in response_json_databases:
for database_info in database_group["databases"]:
if str(database_info["name"]).endswith("seqdef"):
known_seqdef_dbs[database_info["name"]] = known_bigsdb
self._known_seqdef_dbs_origin = dict(known_seqdef_dbs)
return self._known_seqdef_dbs_origin
async def get_bigsdb_api_from_seqdefdb(self, seqdef_db_name: str) -> str:
known_databases = await self.get_known_seqdef_dbs()
if seqdef_db_name not in known_databases:
raise NoSuchBIGSdbDatabaseException(seqdef_db_name)
return known_databases[seqdef_db_name]
async def get_schemes_for_seqdefdb(self, seqdef_db_name: str, force: bool = False) -> Mapping[str, int]:
if seqdef_db_name in self._seqdefdb_schemes and not force:
return self._seqdefdb_schemes[seqdef_db_name] # type: ignore since it's guaranteed to not be none by conditional
uri_path = f"{await self.get_bigsdb_api_from_seqdefdb(seqdef_db_name)}/db/{seqdef_db_name}/schemes"
async with self._http_client.get(uri_path) as response:
response_json = await response.json()
scheme_descriptions: Mapping[str, int] = dict()
for scheme_definition in response_json["schemes"]:
scheme_id: int = int(str(scheme_definition["scheme"]).split("/")[-1])
scheme_desc: str = scheme_definition["description"]
scheme_descriptions[scheme_desc] = scheme_id
self._seqdefdb_schemes[seqdef_db_name] = scheme_descriptions
return self._seqdefdb_schemes[seqdef_db_name] # type: ignore
async def build_profiler_from_seqdefdb(self, local: bool, dbseqdef_name: str, scheme_id: int) -> BIGSdbMLSTProfiler:
return get_BIGSdb_MLST_profiler(local, await self.get_bigsdb_api_from_seqdefdb(dbseqdef_name), dbseqdef_name, scheme_id)
async def close(self):
await self._http_client.close()
async def __aexit__(self, exc_type, exc_value, traceback):
await self.close()
def get_BIGSdb_MLST_profiler(local: bool, database_api: str, database_name: str, scheme_id: int):
if local:
raise NotImplementedError()
return RemoteBIGSdbMLSTProfiler(database_api=database_api, database_name=database_name, scheme_id=scheme_id)

View File

@@ -1,41 +0,0 @@
import csv
from os import PathLike
from typing import AsyncIterable, Mapping, Sequence, Union
from autobigs.engine.data.structures.mlst import Allele, MLSTProfile
def dict_loci_alleles_variants_from_loci(alleles_map: Mapping[str, Sequence[Allele]]):
result_dict: dict[str, Union[list[str], str]] = {}
for loci, alleles in alleles_map.items():
if len(alleles) == 1:
result_dict[loci] = alleles[0].allele_variant
else:
result_locis = list()
for allele in alleles:
result_locis.append(allele.allele_variant)
result_dict[loci] = result_locis
return result_dict
async def write_mlst_profiles_as_csv(mlst_profiles_iterable: AsyncIterable[tuple[str, Union[MLSTProfile, None]]], handle: Union[str, bytes, PathLike[str], PathLike[bytes]]) -> Sequence[str]:
failed = list()
with open(handle, "w", newline='') as filehandle:
header = None
writer: Union[csv.DictWriter, None] = None
async for name, mlst_profile in mlst_profiles_iterable:
if mlst_profile is None:
failed.append(name)
continue
if writer is None:
header = ["id", "st", "clonal-complex", *mlst_profile.alleles.keys()]
writer = csv.DictWriter(filehandle, fieldnames=header)
writer.writeheader()
row_dictionary = {
"st": mlst_profile.sequence_type,
"clonal-complex": mlst_profile.clonal_complex,
"id": name,
**dict_loci_alleles_variants_from_loci(mlst_profile.alleles)
}
writer.writerow(rowdict=row_dictionary)
return failed

View File

@@ -1,16 +0,0 @@
import asyncio
from io import TextIOWrapper
from typing import Any, AsyncGenerator, Generator, Iterable, Sequence, Union
from Bio import SeqIO
from autobigs.engine.data.structures.genomics import NamedString
async def read_fasta(handle: Union[str, TextIOWrapper]) -> AsyncGenerator[NamedString, Any]:
fasta_sequences = asyncio.to_thread(SeqIO.parse, handle=handle, format="fasta")
for fasta_sequence in await fasta_sequences:
yield NamedString(fasta_sequence.id, str(fasta_sequence.seq))
async def read_multiple_fastas(handles: Iterable[Union[str, TextIOWrapper]]) -> AsyncGenerator[NamedString, Any]:
for handle in handles:
async for named_seq in read_fasta(handle):
yield named_seq

View File

@@ -1,166 +0,0 @@
from collections import defaultdict
from contextlib import AbstractAsyncContextManager
from numbers import Number
from typing import Any, AsyncGenerator, AsyncIterable, Collection, Generator, Iterable, Mapping, Sequence, Union
from aiohttp import ClientSession, ClientTimeout
from autobigs.engine.data.structures.genomics import NamedString
from autobigs.engine.data.structures.mlst import Allele, PartialAllelicMatchProfile, MLSTProfile
from autobigs.engine.exceptions.database import NoBIGSdbExactMatchesException, NoBIGSdbMatchesException, NoSuchBIGSdbDatabaseException
class BIGSdbMLSTProfiler(AbstractAsyncContextManager):
def __init__(self, database_api: str, database_name: str, schema_id: int):
self._database_name = database_name
self._schema_id = schema_id
self._base_url = f"{database_api}/db/{self._database_name}/schemes/{self._schema_id}/"
self._http_client = ClientSession(self._base_url, timeout=ClientTimeout(10000))
async def __aenter__(self):
return self
async def fetch_mlst_allele_variants(self, sequence_string: str, exact: bool) -> AsyncGenerator[Allele, Any]:
# See https://bigsdb.pasteur.fr/api/db/pubmlst_bordetella_seqdef/schemes
uri_path = "sequence"
response = await self._http_client.post(uri_path, json={
"sequence": sequence_string,
"partial_matches": not exact
})
sequence_response: dict = await response.json()
if "exact_matches" in sequence_response:
# loci -> list of alleles with id and loci
exact_matches: dict[str, Sequence[dict[str, str]]] = sequence_response["exact_matches"]
for allele_loci, alleles in exact_matches.items():
for allele in alleles:
alelle_id = allele["allele_id"]
yield Allele(allele_loci=allele_loci, allele_variant=alelle_id, partial_match_profile=None)
elif "partial_matches" in sequence_response:
if exact:
raise NoBIGSdbExactMatchesException(self._database_name, self._schema_id)
partial_matches: dict[str, dict[str, Union[str, float, int]]] = sequence_response["partial_matches"]
for allele_loci, partial_match in partial_matches.items():
if len(partial_match) <= 0:
continue
partial_match_profile = PartialAllelicMatchProfile(
percent_identity=float(partial_match["identity"]),
mismatches=int(partial_match["mismatches"]),
bitscore=float(partial_match["bitscore"]),
gaps=int(partial_match["gaps"])
)
yield Allele(
allele_loci=allele_loci,
allele_variant=str(partial_match["allele"]),
partial_match_profile=partial_match_profile
)
else:
raise NoBIGSdbMatchesException(self._database_name, self._schema_id)
async def fetch_mlst_st(self, alleles: Union[AsyncIterable[Allele], Iterable[Allele]]) -> MLSTProfile:
uri_path = "designations"
allele_request_dict: dict[str, list[dict[str, str]]] = defaultdict(list)
if isinstance(alleles, AsyncIterable):
async for allele in alleles:
allele_request_dict[allele.allele_loci].append({"allele": str(allele.allele_variant)})
else:
for allele in alleles:
allele_request_dict[allele.allele_loci].append({"allele": str(allele.allele_variant)})
request_json = {
"designations": allele_request_dict
}
async with self._http_client.post(uri_path, json=request_json) as response:
response_json: dict = await response.json()
allele_map: dict[str, list[Allele]] = defaultdict(list)
response_json.setdefault("fields", dict())
schema_fields_returned: dict[str, str] = response_json["fields"]
schema_fields_returned.setdefault("ST", "unknown")
schema_fields_returned.setdefault("clonal_complex", "unknown")
schema_exact_matches: dict = response_json["exact_matches"]
for exact_match_loci, exact_match_alleles in schema_exact_matches.items():
for exact_match_allele in exact_match_alleles:
allele_map[exact_match_loci].append(Allele(exact_match_loci, exact_match_allele["allele_id"], None))
if len(allele_map) == 0:
raise ValueError("Passed in no alleles.")
return MLSTProfile(dict(allele_map), schema_fields_returned["ST"], schema_fields_returned["clonal_complex"])
async def profile_string(self, string: str, exact: bool = False) -> MLSTProfile:
alleles = self.fetch_mlst_allele_variants(string, exact)
return await self.fetch_mlst_st(alleles)
async def profile_multiple_strings(self, namedStrings: AsyncIterable[NamedString], exact: bool = False, stop_on_fail: bool = False) -> AsyncGenerator[tuple[str, Union[MLSTProfile, None]], Any]:
async for named_string in namedStrings:
try:
yield (named_string.name, await self.profile_string(named_string.sequence, exact))
except NoBIGSdbMatchesException as e:
if stop_on_fail:
raise e
yield (named_string.name, None)
async def close(self):
await self._http_client.close()
async def __aexit__(self, exc_type, exc_value, traceback):
await self.close()
class BIGSdbIndex(AbstractAsyncContextManager):
KNOWN_BIGSDB_APIS = {
"https://bigsdb.pasteur.fr/api",
"https://rest.pubmlst.org"
}
def __init__(self):
self._http_client = ClientSession()
self._known_seqdef_dbs_origin: Union[Mapping[str, str], None] = None
self._seqdefdb_schemas: dict[str, Union[Mapping[str, int], None]] = dict()
super().__init__()
async def __aenter__(self):
return self
async def get_known_seqdef_dbs(self, force: bool = False) -> Mapping[str, str]:
if self._known_seqdef_dbs_origin is not None and not force:
return self._known_seqdef_dbs_origin
known_seqdef_dbs = dict()
for known_bigsdb in BIGSdbIndex.KNOWN_BIGSDB_APIS:
async with self._http_client.get(f"{known_bigsdb}/db") as response:
response_json_databases = await response.json()
for database_group in response_json_databases:
for database_info in database_group["databases"]:
if str(database_info["name"]).endswith("seqdef"):
known_seqdef_dbs[database_info["name"]] = known_bigsdb
self._known_seqdef_dbs_origin = dict(known_seqdef_dbs)
return self._known_seqdef_dbs_origin
async def get_bigsdb_api_from_seqdefdb(self, seqdef_db_name: str) -> str:
known_databases = await self.get_known_seqdef_dbs()
if seqdef_db_name not in known_databases:
raise NoSuchBIGSdbDatabaseException(seqdef_db_name)
return known_databases[seqdef_db_name]
async def get_schemas_for_seqdefdb(self, seqdef_db_name: str, force: bool = False) -> Mapping[str, int]:
if seqdef_db_name in self._seqdefdb_schemas and not force:
return self._seqdefdb_schemas[seqdef_db_name] # type: ignore since it's guaranteed to not be none by conditional
uri_path = f"{await self.get_bigsdb_api_from_seqdefdb(seqdef_db_name)}/db/{seqdef_db_name}/schemes"
async with self._http_client.get(uri_path) as response:
response_json = await response.json()
schema_descriptions: Mapping[str, int] = dict()
for scheme_definition in response_json["schemes"]:
scheme_id: int = int(str(scheme_definition["scheme"]).split("/")[-1])
scheme_desc: str = scheme_definition["description"]
schema_descriptions[scheme_desc] = scheme_id
self._seqdefdb_schemas[seqdef_db_name] = schema_descriptions
return self._seqdefdb_schemas[seqdef_db_name] # type: ignore
async def build_profiler_from_seqdefdb(self, dbseqdef_name: str, schema_id: int) -> BIGSdbMLSTProfiler:
return BIGSdbMLSTProfiler(await self.get_bigsdb_api_from_seqdefdb(dbseqdef_name), dbseqdef_name, schema_id)
async def close(self):
await self._http_client.close()
async def __aexit__(self, exc_type, exc_value, traceback):
await self.close()

View File

@@ -1,21 +0,0 @@
from dataclasses import dataclass
from typing import Mapping, Sequence, Union
@dataclass(frozen=True)
class PartialAllelicMatchProfile:
percent_identity: float
mismatches: int
bitscore: float
gaps: int
@dataclass(frozen=True)
class Allele:
allele_loci: str
allele_variant: str
partial_match_profile: Union[None, PartialAllelicMatchProfile]
@dataclass(frozen=True)
class MLSTProfile:
alleles: Mapping[str, Sequence[Allele]]
sequence_type: str
clonal_complex: str

View File

@@ -5,17 +5,21 @@ class BIGSDbDatabaseAPIException(Exception):
class NoBIGSdbMatchesException(BIGSDbDatabaseAPIException):
def __init__(self, database_name: str, database_schema_id: int, *args):
super().__init__(f"No matches found with schema with ID {database_schema_id} in the database \"{database_name}\".", *args)
def __init__(self, database_name: str, database_scheme_id: int, query_name: Union[None, str], *args):
self._query_name = query_name
super().__init__(f"No matches found with scheme with ID {database_scheme_id} in the database \"{database_name}\".", *args)
def get_causal_query_name(self) -> Union[str, None]:
return self._query_name
class NoBIGSdbExactMatchesException(NoBIGSdbMatchesException):
def __init__(self, database_name: str, database_schema_id: int, *args):
super().__init__(f"No exact match found with schema with ID {database_schema_id} in the database \"{database_name}\".", *args)
def __init__(self, database_name: str, database_scheme_id: int, *args):
super().__init__(f"No exact match found with scheme with ID {database_scheme_id} in the database \"{database_name}\".", *args)
class NoSuchBIGSdbDatabaseException(BIGSDbDatabaseAPIException):
def __init__(self, database_name: str, *args):
super().__init__(f"No database \"{database_name}\" found.", *args)
class NoSuchBigSdbSchemaException(BIGSDbDatabaseAPIException):
def __init__(self, database_name: str, database_schema_id: int, *args):
super().__init__(f"No schema with ID {database_schema_id} in \"{database_name}\" found.", *args)
class NoSuchBigSdbschemeException(BIGSDbDatabaseAPIException):
def __init__(self, database_name: str, database_scheme_id: int, *args):
super().__init__(f"No scheme with ID {database_scheme_id} in \"{database_name}\" found.", *args)

View File

@@ -0,0 +1,20 @@
import asyncio
from io import TextIOWrapper
from typing import Any, AsyncGenerator, Iterable, Union
from Bio import SeqIO
from autobigs.engine.structures.genomics import NamedString
async def read_fasta(handle: Union[str, TextIOWrapper]) -> Iterable[NamedString]:
fasta_sequences = asyncio.to_thread(SeqIO.parse, handle=handle, format="fasta")
results = []
for fasta_sequence in await fasta_sequences:
results.append(NamedString(fasta_sequence.id, str(fasta_sequence.seq)))
return results
async def read_multiple_fastas(handles: Iterable[Union[str, TextIOWrapper]]) -> AsyncGenerator[Iterable[NamedString], Any]:
tasks = []
for handle in handles:
tasks.append(read_fasta(handle))
for task in asyncio.as_completed(tasks):
yield await task

View File

@@ -0,0 +1,18 @@
from dataclasses import dataclass
from numbers import Number
from typing import Sequence
@dataclass(frozen=True)
class AlignmentStats:
percent_identity: float
mismatches: int
gaps: int
match_metric: int
@dataclass(frozen=True)
class PairwiseAlignment:
reference: str
query: str
reference_indices: Sequence[Number]
query_indices: Sequence[Number]
alignment_stats: AlignmentStats

View File

@@ -25,7 +25,7 @@ class SangerTraceData(NamedString):
analysis_proto_settings_name: str
analysis_rpto_settings_ver: str
analysis_proto_xml_data: str
analysis_proto_xml_schema_ver: str
analysis_proto_xml_scheme_ver: str
sample_comment: Union[None, str]
capillary_machine: bool
container_identifier: str

View File

@@ -0,0 +1,33 @@
from collections import defaultdict
from dataclasses import dataclass
from typing import Collection, Iterable, Mapping, Sequence, Union
from autobigs.engine.structures.alignment import AlignmentStats
@dataclass(frozen=True)
class Allele:
allele_locus: str
allele_variant: str
partial_match_profile: Union[None, AlignmentStats]
@dataclass(frozen=True)
class MLSTProfile:
alleles: Collection[Allele]
sequence_type: str
clonal_complex: str
@dataclass(frozen=True)
class NamedMLSTProfile:
name: str
mlst_profile: Union[None, MLSTProfile]
def alleles_to_mapping(alleles: Iterable[Allele]):
result = defaultdict(list)
for allele in alleles:
result[allele.allele_locus].append(allele.allele_variant)
result = dict(result)
for locus, variant in result.items():
if len(variant) == 1:
result[locus] = variant[0]
return result

View File

@@ -0,0 +1,43 @@
from collections import defaultdict
import csv
from os import PathLike
from typing import AsyncIterable, Collection, Mapping, Sequence, Union
from autobigs.engine.structures.mlst import Allele, MLSTProfile, NamedMLSTProfile
def alleles_to_text_map(alleles: Collection[Allele]) -> Mapping[str, Union[Sequence[str], str]]:
result = defaultdict(list)
for allele in alleles:
result[allele.allele_locus].append(allele.allele_variant + ("*" if allele.partial_match_profile is not None else ""))
for locus in result.keys():
if len(result[locus]) == 1:
result[locus] = result[locus][0] # Take the only one
else:
result[locus] = tuple(result[locus]) # type: ignore
return dict(result)
async def write_mlst_profiles_as_csv(mlst_profiles_iterable: AsyncIterable[NamedMLSTProfile], handle: Union[str, bytes, PathLike[str], PathLike[bytes]]) -> Sequence[str]:
failed = list()
with open(handle, "w", newline='') as filehandle:
header = None
writer: Union[csv.DictWriter, None] = None
async for named_mlst_profile in mlst_profiles_iterable:
name = named_mlst_profile.name
mlst_profile = named_mlst_profile.mlst_profile
if mlst_profile is None:
failed.append(name)
continue
allele_mapping = alleles_to_text_map(mlst_profile.alleles)
if writer is None:
header = ["id", "st", "clonal-complex", *sorted(allele_mapping.keys())]
writer = csv.DictWriter(filehandle, fieldnames=header)
writer.writeheader()
row_dictionary = {
"st": mlst_profile.sequence_type,
"clonal-complex": mlst_profile.clonal_complex,
"id": name,
**allele_mapping
}
writer.writerow(rowdict=row_dictionary)
return failed

View File

@@ -0,0 +1,214 @@
from os import path
import random
import re
from typing import Callable, Collection, Sequence, Union
from Bio import SeqIO
import pytest
from autobigs.engine.analysis import bigsdb
from autobigs.engine.structures import mlst
from autobigs.engine.structures.genomics import NamedString
from autobigs.engine.structures.mlst import Allele, MLSTProfile
from autobigs.engine.exceptions.database import NoBIGSdbExactMatchesException, NoBIGSdbMatchesException
from autobigs.engine.analysis.bigsdb import BIGSdbIndex, BIGSdbMLSTProfiler, RemoteBIGSdbMLSTProfiler
async def generate_async_iterable(normal_iterable):
for dummy_sequence in normal_iterable:
yield dummy_sequence
def gene_scrambler(gene: str, mutation_site_count: Union[int, float], alphabet: Sequence[str] = ["A", "T", "C", "G"]):
rand = random.Random(gene)
if isinstance(mutation_site_count, float):
mutation_site_count = int(mutation_site_count * len(gene))
random_locations = rand.choices(range(len(gene)), k=mutation_site_count)
scrambled = list(gene)
for random_location in random_locations:
scrambled[random_location] = rand.choice(alphabet)
return "".join(scrambled)
def get_first_sequence_from_fasta(resource: str):
return str(SeqIO.read(path.join("tests/resources/", resource), "fasta").seq)
def get_multiple_sequences_from_fasta(resource: str):
return tuple(SeqIO.parse(path.join("tests/resources/", resource), "fasta"))
bpertussis_tohamaI_profile = MLSTProfile((
Allele("adk", "1", None),
Allele("fumC", "1", None),
Allele("glyA", "1", None),
Allele("tyrB", "1", None),
Allele("icd", "1", None),
Allele("pepA", "1", None),
Allele("pgm", "1", None)), "1", "ST-2 complex")
bpertussis_tohamaI_bad_profile = MLSTProfile((
Allele("adk", "1", None),
Allele("fumC", "2", None),
Allele("glyA", "36", None),
Allele("tyrB", "4", None),
Allele("icd", "4", None),
Allele("pepA", "1", None),
Allele("pgm", "5", None),
), "unknown", "unknown")
hinfluenzae_2014_102_profile = MLSTProfile((
Allele("adk", "28", None),
Allele("atpG", "33", None),
Allele("frdB", "7", None),
Allele("fucK", "18", None),
Allele("mdh", "11", None),
Allele("pgi", "125", None),
Allele("recA", "89", None)
), "478", "unknown")
hinfluenzae_2014_102_bad_profile = MLSTProfile((
Allele("adk", "3", None),
Allele("atpG", "121", None),
Allele("frdB", "6", None),
Allele("fucK", "5", None),
Allele("mdh", "12", None),
Allele("pgi", "4", None),
Allele("recA", "5", None)
), "unknown", "unknown")
@pytest.mark.parametrize("local_db,database_api,database_name,scheme_id,seq_path,feature_seqs_path,expected_profile,bad_profile", [
(False, "https://bigsdb.pasteur.fr/api", "pubmlst_bordetella_seqdef", 3, "tohama_I_bpertussis.fasta", "tohama_I_bpertussis_features.fasta", bpertussis_tohamaI_profile, bpertussis_tohamaI_bad_profile),
(False, "https://rest.pubmlst.org", "pubmlst_hinfluenzae_seqdef", 1, "2014-102_hinfluenza.fasta", "2014-102_hinfluenza_features.fasta", hinfluenzae_2014_102_profile, hinfluenzae_2014_102_bad_profile),
])
class TestBIGSdbMLSTProfiler:
async def test_profiling_results_in_exact_matches_when_exact(self, local_db, database_api, database_name, scheme_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
sequence = get_first_sequence_from_fasta(seq_path)
async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, scheme_id) as dummy_profiler:
expected_alleles = mlst.alleles_to_mapping(expected_profile.alleles)
targets_left = set(mlst.alleles_to_mapping(expected_profile.alleles).keys())
async for exact_match in dummy_profiler.determine_mlst_allele_variants(query_sequence_strings=[sequence]):
assert isinstance(exact_match, Allele)
assert exact_match.allele_locus in expected_alleles
assert exact_match.allele_variant == expected_alleles[exact_match.allele_locus]
targets_left.remove(exact_match.allele_locus)
assert len(targets_left) == 0
async def test_sequence_profiling_non_exact_returns_non_exact(self, local_db, database_api, database_name, scheme_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
target_sequences = get_multiple_sequences_from_fasta(feature_seqs_path)
mlst_targets = {x.lower() for x in mlst.alleles_to_mapping(expected_profile.alleles).keys()}
async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, scheme_id) as profiler:
for target_sequence in target_sequences:
match = re.fullmatch(r".*\[gene=([\w\d]+)\].*", target_sequence.description)
if match is None:
continue
gene = match.group(1).lower()
if gene not in mlst_targets:
continue
scrambled = gene_scrambler(str(target_sequence.seq), 0.125)
async for partial_match in profiler.determine_mlst_allele_variants([scrambled]):
assert isinstance(partial_match, Allele)
assert partial_match.partial_match_profile is not None
mlst_targets.remove(gene)
assert len(mlst_targets) == 0
async def test_profiling_results_in_correct_mlst_st(self, local_db, database_api, database_name, scheme_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, scheme_id) as dummy_profiler:
mlst_st_data = await dummy_profiler.determine_mlst_st(expected_profile.alleles)
assert mlst_st_data is not None
assert isinstance(mlst_st_data, MLSTProfile)
assert mlst_st_data.clonal_complex == expected_profile.clonal_complex
assert mlst_st_data.sequence_type == expected_profile.sequence_type
async def test_profiling_non_exact_results_in_list_of_mlsts(self, local_db, database_api, database_name, scheme_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
dummy_alleles = bad_profile.alleles
async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, scheme_id) as dummy_profiler:
mlst_profile = await dummy_profiler.determine_mlst_st(dummy_alleles)
assert isinstance(mlst_profile, MLSTProfile)
assert mlst_profile.clonal_complex == "unknown"
assert mlst_profile.sequence_type == "unknown"
async def test_bigsdb_profile_multiple_strings_same_string_twice(self, local_db, database_api, database_name, scheme_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
sequence = get_first_sequence_from_fasta(seq_path)
dummy_sequences = [[NamedString("seq1", sequence)], [NamedString("seq2", sequence)]]
async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, scheme_id) as dummy_profiler:
async for named_profile in dummy_profiler.profile_multiple_strings(generate_async_iterable(dummy_sequences)):
name, profile = named_profile.name, named_profile.mlst_profile
assert profile is not None
assert isinstance(profile, MLSTProfile)
assert profile.clonal_complex == expected_profile.clonal_complex
assert profile.sequence_type == expected_profile.sequence_type
async def test_bigsdb_profile_multiple_strings_exactmatch_fail_second_no_stop(self, local_db, database_api, database_name, scheme_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
valid_seq = get_first_sequence_from_fasta(seq_path)
dummy_sequences = [[NamedString("seq1", valid_seq)], [NamedString("should_fail", gene_scrambler(valid_seq, 0.3))], [NamedString("seq3", valid_seq)]]
async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, scheme_id) as dummy_profiler:
async for name_profile in dummy_profiler.profile_multiple_strings(generate_async_iterable(dummy_sequences), True):
name, profile = name_profile.name, name_profile.mlst_profile
assert profile is not None
if name == "should_fail":
assert profile.clonal_complex == "unknown"
assert profile.sequence_type == "unknown"
assert len(profile.alleles) > 0
else:
assert isinstance(profile, MLSTProfile)
assert profile.clonal_complex == expected_profile.clonal_complex
assert profile.sequence_type == expected_profile.sequence_type
async def test_bigsdb_profile_multiple_strings_nonexact_second_no_stop(self, local_db, database_api, database_name, scheme_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
valid_seq = get_first_sequence_from_fasta(seq_path)
dummy_sequences = [[NamedString("seq1", valid_seq)], [NamedString("should_fail", gene_scrambler(valid_seq, 0.3))], [NamedString("seq3", valid_seq)]]
async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, scheme_id) as dummy_profiler:
async for named_profile in dummy_profiler.profile_multiple_strings(generate_async_iterable(dummy_sequences), False):
name, profile = named_profile.name, named_profile.mlst_profile
assert profile is not None
if name == "should_fail":
assert profile.clonal_complex == "unknown"
assert profile.sequence_type == "unknown"
assert len(profile.alleles) > 0
else:
assert isinstance(profile, MLSTProfile)
assert profile.clonal_complex == expected_profile.clonal_complex
assert profile.sequence_type == expected_profile.sequence_type
class TestBIGSdbIndex:
async def test_bigsdb_index_all_databases_is_not_empty(self):
async with BIGSdbIndex() as bigsdb_index:
assert len(await bigsdb_index.get_known_seqdef_dbs()) > 0
async def test_bigsdb_index_references_pubmlst_correctly(self):
async with BIGSdbIndex() as bigsdb_index:
assert (await bigsdb_index.get_bigsdb_api_from_seqdefdb("pubmlst_hinfluenzae_seqdef")) == "https://rest.pubmlst.org"
async def test_bigsdb_index_references_institutpasteur_correctly(self):
async with BIGSdbIndex() as bigsdb_index:
assert (await bigsdb_index.get_bigsdb_api_from_seqdefdb("pubmlst_bordetella_seqdef")) == "https://bigsdb.pasteur.fr/api"
async def test_bigsdb_index_get_schemes_for_bordetella(self):
async with BIGSdbIndex() as index:
schemes = await index.get_schemes_for_seqdefdb(seqdef_db_name="pubmlst_bordetella_seqdef")
assert len(schemes.keys()) > 0
assert "MLST" in schemes
assert isinstance(schemes["MLST"], int)
async def test_bigsdb_index_get_databases_has_only_seqdef(self):
async with BIGSdbIndex() as index:
databases = await index.get_known_seqdef_dbs()
assert len(databases.keys()) > 0
for database_name in databases.keys():
assert database_name.endswith("seqdef")
assert databases["pubmlst_bordetella_seqdef"] == "https://bigsdb.pasteur.fr/api"
@pytest.mark.parametrize("local", [
(False)
])
async def test_bigsdb_index_instantiates_correct_profiler(self, local):
sequence = str(SeqIO.read("tests/resources/tohama_I_bpertussis.fasta", "fasta").seq)
async with BIGSdbIndex() as bigsdb_index:
async with await bigsdb_index.build_profiler_from_seqdefdb(local, "pubmlst_bordetella_seqdef", 3) as profiler:
assert isinstance(profiler, BIGSdbMLSTProfiler)
profile = await profiler.profile_string(sequence)
assert isinstance(profile, MLSTProfile)
assert profile.clonal_complex == "ST-2 complex"
assert profile.sequence_type == "1"

View File

@@ -1,21 +0,0 @@
from autobigs.engine.data.local.csv import dict_loci_alleles_variants_from_loci
from autobigs.engine.data.structures.mlst import Allele
def test_dict_loci_alleles_variants_from_loci_single_loci_not_list():
alleles_map = {
"adk": [Allele("adk", "1", None)]
}
results = dict_loci_alleles_variants_from_loci(alleles_map)
for loci, variant in results.items():
assert isinstance(variant, str)
assert variant == "1"
def test_dict_loci_alleles_variants_from_loci_multi_loci_is_list():
alleles_map = {
"adk": [Allele("adk", "1", None), Allele("adk", "2", None)]
}
results = dict_loci_alleles_variants_from_loci(alleles_map)
for loci, variant in results.items():
assert isinstance(variant, list)
assert len(variant) == 2

View File

@@ -1,7 +0,0 @@
from autobigs.engine.data.local.fasta import read_fasta
async def test_fasta_reader_not_none():
named_strings = read_fasta("tests/resources/tohama_I_bpertussis.fasta")
async for named_string in named_strings:
assert named_string.name == "BX470248.1"

View File

@@ -1,244 +0,0 @@
import random
import re
from typing import Collection, Sequence, Union
from Bio import SeqIO
import pytest
from autobigs.engine.data.structures.genomics import NamedString
from autobigs.engine.data.structures.mlst import Allele, MLSTProfile
from autobigs.engine.exceptions.database import NoBIGSdbExactMatchesException, NoBIGSdbMatchesException
from autobigs.engine.data.remote.databases.bigsdb import BIGSdbIndex, BIGSdbMLSTProfiler
def gene_scrambler(gene: str, mutation_site_count: Union[int, float], alphabet: Sequence[str] = ["A", "T", "C", "G"]):
rand = random.Random(gene)
if isinstance(mutation_site_count, float):
mutation_site_count = int(mutation_site_count * len(gene))
random_locations = rand.choices(range(len(gene)), k=mutation_site_count)
scrambled = list(gene)
for random_location in random_locations:
scrambled[random_location] = rand.choice(alphabet)
return "".join(scrambled)
async def test_institutpasteur_profiling_results_in_exact_matches_when_exact():
sequence = str(SeqIO.read("tests/resources/tohama_I_bpertussis.fasta", "fasta").seq)
async with BIGSdbMLSTProfiler(database_api="https://bigsdb.pasteur.fr/api", database_name="pubmlst_bordetella_seqdef", schema_id=3) as dummy_profiler:
targets_left = {"adk", "fumC", "glyA", "tyrB", "icd", "pepA", "pgm"}
async for exact_match in dummy_profiler.fetch_mlst_allele_variants(sequence_string=sequence, exact=True):
assert isinstance(exact_match, Allele)
assert exact_match.allele_variant == '1' # All of Tohama I has allele id I
targets_left.remove(exact_match.allele_loci)
assert len(targets_left) == 0
async def test_institutpasteur_sequence_profiling_non_exact_returns_non_exact():
sequences = list(SeqIO.parse("tests/resources/tohama_I_bpertussis_coding.fasta", "fasta"))
mlst_targets = {"adk", "fumc", "glya", "tyrb", "icd", "pepa", "pgm"}
async with BIGSdbMLSTProfiler(database_api="https://bigsdb.pasteur.fr/api", database_name="pubmlst_bordetella_seqdef", schema_id=3) as profiler:
for sequence in sequences:
match = re.fullmatch(r".*\[gene=([\w\d]+)\].*", sequence.description)
if match is None:
continue
gene = match.group(1)
if gene.lower() not in mlst_targets:
continue
scrambled = gene_scrambler(str(sequence.seq), 0.125)
async for partial_match in profiler.fetch_mlst_allele_variants(scrambled, False):
assert partial_match.partial_match_profile is not None
mlst_targets.remove(gene.lower())
assert len(mlst_targets) == 0
async def test_institutpasteur_profiling_results_in_correct_mlst_st():
async def dummy_allele_generator():
dummy_alleles = [
Allele("adk", "1", None),
Allele("fumC", "1", None),
Allele("glyA", "1", None),
Allele("tyrB", "1", None),
Allele("icd", "1", None),
Allele("pepA", "1", None),
Allele("pgm", "1", None),
]
for dummy_allele in dummy_alleles:
yield dummy_allele
async with BIGSdbMLSTProfiler(database_api="https://bigsdb.pasteur.fr/api", database_name="pubmlst_bordetella_seqdef", schema_id=3) as dummy_profiler:
mlst_st_data = await dummy_profiler.fetch_mlst_st(dummy_allele_generator())
assert mlst_st_data is not None
assert isinstance(mlst_st_data, MLSTProfile)
assert mlst_st_data.clonal_complex == "ST-2 complex"
assert mlst_st_data.sequence_type == "1"
async def test_institutpasteur_profiling_non_exact_results_in_list_of_mlsts():
dummy_alleles = [
Allele("adk", "1", None),
Allele("fumC", "2", None),
Allele("glyA", "36", None),
Allele("tyrB", "4", None),
Allele("icd", "4", None),
Allele("pepA", "1", None),
Allele("pgm", "5", None),
]
async with BIGSdbMLSTProfiler(database_api="https://bigsdb.pasteur.fr/api", database_name="pubmlst_bordetella_seqdef", schema_id=3) as dummy_profiler:
mlst_profile = await dummy_profiler.fetch_mlst_st(dummy_alleles)
assert mlst_profile.clonal_complex == "unknown"
assert mlst_profile.sequence_type == "unknown"
async def test_institutpasteur_sequence_profiling_is_correct():
sequence = str(SeqIO.read("tests/resources/tohama_I_bpertussis.fasta", "fasta").seq)
async with BIGSdbMLSTProfiler(database_api="https://bigsdb.pasteur.fr/api", database_name="pubmlst_bordetella_seqdef", schema_id=3) as dummy_profiler:
profile = await dummy_profiler.profile_string(sequence)
assert profile is not None
assert isinstance(profile, MLSTProfile)
assert profile.clonal_complex == "ST-2 complex"
assert profile.sequence_type == "1"
async def test_pubmlst_profiling_results_in_exact_matches_when_exact():
dummy_alleles = {
Allele("adk", "1", None),
Allele("atpG", "1", None),
Allele("frdB", "1", None),
Allele("fucK", "1", None),
Allele("mdh", "1", None),
Allele("pgi", "1", None),
Allele("recA", "5", None),
}
sequence = str(SeqIO.read("tests/resources/FDAARGOS_1560.fasta", "fasta").seq)
async with BIGSdbMLSTProfiler(database_api="https://rest.pubmlst.org/", database_name="pubmlst_hinfluenzae_seqdef", schema_id=1) as dummy_profiler:
exact_matches = dummy_profiler.fetch_mlst_allele_variants(sequence_string=sequence, exact=True)
async for exact_match in exact_matches:
assert isinstance(exact_match, Allele)
dummy_alleles.remove(exact_match)
assert len(dummy_alleles) == 0
async def test_pubmlst_profiling_results_in_correct_st():
async def generate_dummy_targets():
dummy_alleles = [
Allele("adk", "1", None),
Allele("atpG", "1", None),
Allele("frdB", "1", None),
Allele("fucK", "1", None),
Allele("mdh", "1", None),
Allele("pgi", "1", None),
Allele("recA", "5", None),
]
for dummy_allele in dummy_alleles:
yield dummy_allele
async with BIGSdbMLSTProfiler(database_api="https://rest.pubmlst.org/", database_name="pubmlst_hinfluenzae_seqdef", schema_id=1) as dummy_profiler:
mlst_st_data = await dummy_profiler.fetch_mlst_st(generate_dummy_targets())
assert mlst_st_data is not None
assert isinstance(mlst_st_data, MLSTProfile)
assert mlst_st_data.clonal_complex == "ST-3 complex"
assert mlst_st_data.sequence_type == "3"
async def test_pubmlst_sequence_profiling_is_correct():
sequence = str(SeqIO.read("tests/resources/FDAARGOS_1560.fasta", "fasta").seq)
async with BIGSdbMLSTProfiler(database_api="https://rest.pubmlst.org/", database_name="pubmlst_hinfluenzae_seqdef", schema_id=1) as dummy_profiler:
profile = await dummy_profiler.profile_string(sequence)
assert profile is not None
assert isinstance(profile, MLSTProfile)
assert profile.clonal_complex == "ST-3 complex"
assert profile.sequence_type == "3"
async def test_bigsdb_index_all_databases_is_not_empty():
async with BIGSdbIndex() as bigsdb_index:
assert len(await bigsdb_index.get_known_seqdef_dbs()) > 0
async def test_bigsdb_index_references_pubmlst_correctly():
async with BIGSdbIndex() as bigsdb_index:
assert (await bigsdb_index.get_bigsdb_api_from_seqdefdb("pubmlst_hinfluenzae_seqdef")) == "https://rest.pubmlst.org"
async def test_bigsdb_index_references_institutpasteur_correctly():
async with BIGSdbIndex() as bigsdb_index:
assert (await bigsdb_index.get_bigsdb_api_from_seqdefdb("pubmlst_bordetella_seqdef")) == "https://bigsdb.pasteur.fr/api"
async def test_bigsdb_index_instantiates_correct_profiler():
sequence = str(SeqIO.read("tests/resources/tohama_I_bpertussis.fasta", "fasta").seq)
async with BIGSdbIndex() as bigsdb_index:
async with await bigsdb_index.build_profiler_from_seqdefdb("pubmlst_bordetella_seqdef", 3) as profiler:
profile = await profiler.profile_string(sequence)
assert profile.clonal_complex == "ST-2 complex"
assert profile.sequence_type == "1"
async def test_bigsdb_profile_multiple_strings_same_string_twice():
sequence = str(SeqIO.read("tests/resources/tohama_I_bpertussis.fasta", "fasta").seq)
dummy_sequences = [NamedString("seq1", sequence), NamedString("seq2", sequence)]
async def generate_async_iterable_sequences():
for dummy_sequence in dummy_sequences:
yield dummy_sequence
async with BIGSdbMLSTProfiler(database_api="https://bigsdb.pasteur.fr/api", database_name="pubmlst_bordetella_seqdef", schema_id=3) as dummy_profiler:
async for name, profile in dummy_profiler.profile_multiple_strings(generate_async_iterable_sequences()):
assert profile is not None
assert isinstance(profile, MLSTProfile)
assert profile.clonal_complex == "ST-2 complex"
assert profile.sequence_type == "1"
async def test_bigsdb_profile_multiple_strings_exactmatch_fail_second_no_stop():
valid_seq = str(SeqIO.read("tests/resources/tohama_I_bpertussis.fasta", "fasta").seq)
dummy_sequences = [NamedString("seq1", valid_seq), NamedString("should_fail", gene_scrambler(valid_seq, 0.3)), NamedString("seq3", valid_seq)]
async def generate_async_iterable_sequences():
for dummy_sequence in dummy_sequences:
yield dummy_sequence
async with BIGSdbMLSTProfiler(database_api="https://bigsdb.pasteur.fr/api", database_name="pubmlst_bordetella_seqdef", schema_id=3) as dummy_profiler:
async for name, profile in dummy_profiler.profile_multiple_strings(generate_async_iterable_sequences(), True):
if name == "should_fail":
assert profile is None
else:
assert profile is not None
assert isinstance(profile, MLSTProfile)
assert profile.clonal_complex == "ST-2 complex"
assert profile.sequence_type == "1"
async def test_bigsdb_profile_multiple_strings_nonexact_second_no_stop():
valid_seq = str(SeqIO.read("tests/resources/tohama_I_bpertussis.fasta", "fasta").seq)
dummy_sequences = [NamedString("seq1", valid_seq), NamedString("should_fail", gene_scrambler(valid_seq, 0.3)), NamedString("seq3", valid_seq)]
async def generate_async_iterable_sequences():
for dummy_sequence in dummy_sequences:
yield dummy_sequence
async with BIGSdbMLSTProfiler(database_api="https://bigsdb.pasteur.fr/api", database_name="pubmlst_bordetella_seqdef", schema_id=3) as dummy_profiler:
async for name, profile in dummy_profiler.profile_multiple_strings(generate_async_iterable_sequences(), False):
if name == "should_fail":
assert profile is not None
assert profile.clonal_complex == "unknown"
assert profile.sequence_type == "unknown"
assert len(profile.alleles) > 0
else:
assert profile is not None
assert isinstance(profile, MLSTProfile)
assert profile.clonal_complex == "ST-2 complex"
assert profile.sequence_type == "1"
async def test_bigsdb_profile_multiple_strings_fail_second_stop():
valid_seq = str(SeqIO.read("tests/resources/tohama_I_bpertussis.fasta", "fasta").seq)
invalid_seq = str(SeqIO.read("tests/resources/FDAARGOS_1560.fasta", "fasta").seq)
dummy_sequences = [NamedString("seq1", valid_seq), NamedString("should_fail", invalid_seq), NamedString("seq3", valid_seq)]
async def generate_async_iterable_sequences():
for dummy_sequence in dummy_sequences:
yield dummy_sequence
async with BIGSdbMLSTProfiler(database_api="https://bigsdb.pasteur.fr/api", database_name="pubmlst_bordetella_seqdef", schema_id=3) as dummy_profiler:
with pytest.raises(NoBIGSdbMatchesException):
async for name, profile in dummy_profiler.profile_multiple_strings(generate_async_iterable_sequences(), exact=True, stop_on_fail=True):
if name == "should_fail":
pytest.fail("Exception should have been thrown, no exception was thrown.")
else:
assert profile is not None
assert isinstance(profile, MLSTProfile)
assert profile.clonal_complex == "ST-2 complex"
assert profile.sequence_type == "1"
async def test_bigsdb_index_get_schemas_for_bordetella():
async with BIGSdbIndex() as index:
schemas = await index.get_schemas_for_seqdefdb(seqdef_db_name="pubmlst_bordetella_seqdef")
assert len(schemas.keys()) > 0
assert "MLST" in schemas
assert isinstance(schemas["MLST"], int)
async def test_bigsdb_index_get_databases_has_only_seqdef():
async with BIGSdbIndex() as index:
databases = await index.get_known_seqdef_dbs()
assert len(databases.keys()) > 0
for database_name in databases.keys():
assert database_name.endswith("seqdef")
assert databases["pubmlst_bordetella_seqdef"] == "https://bigsdb.pasteur.fr/api"

View File

@@ -0,0 +1,7 @@
from autobigs.engine.reading import read_fasta
async def test_fasta_reader_not_none():
named_strings = await read_fasta("tests/resources/tohama_I_bpertussis.fasta")
for named_string in named_strings:
assert named_string.name == "BX470248.1"

View File

@@ -0,0 +1,47 @@
from typing import AsyncIterable, Iterable
import pytest
from autobigs.engine.structures.alignment import AlignmentStats
from autobigs.engine.writing import alleles_to_text_map, write_mlst_profiles_as_csv
from autobigs.engine.structures.mlst import Allele, MLSTProfile, NamedMLSTProfile
import tempfile
from csv import reader
from os import path
@pytest.fixture
def dummy_alphabet_mlst_profile():
return NamedMLSTProfile("name", MLSTProfile((
Allele("A", "1", None),
Allele("D", "1", None),
Allele("B", "1", None),
Allele("C", "1", None),
Allele("C", "2", AlignmentStats(90, 10, 0, 90))
), "mysterious", "very mysterious"))
async def iterable_to_asynciterable(iterable: Iterable):
for iterated in iterable:
yield iterated
async def test_column_order_is_same_as_expected_file(dummy_alphabet_mlst_profile: MLSTProfile):
dummy_profiles = [dummy_alphabet_mlst_profile]
with tempfile.TemporaryDirectory() as temp_dir:
output_path = path.join(temp_dir, "out.csv")
await write_mlst_profiles_as_csv(iterable_to_asynciterable(dummy_profiles), output_path)
with open(output_path) as csv_handle:
csv_reader = reader(csv_handle)
lines = list(csv_reader)
target_columns = lines[4:]
assert target_columns == sorted(target_columns)
async def test_alleles_to_text_map_mapping_is_correct(dummy_alphabet_mlst_profile: NamedMLSTProfile):
mapping = alleles_to_text_map(dummy_alphabet_mlst_profile.mlst_profile.alleles) # type: ignore
expected_mapping = {
"A": "1",
"B": "1",
"C": ("1", "2*"),
"D": "1"
}
for allele_name, allele_ids in mapping.items():
assert allele_name in expected_mapping
assert allele_ids == expected_mapping[allele_name]

File diff suppressed because it is too large Load Diff

File diff suppressed because it is too large Load Diff

File diff suppressed because it is too large Load Diff

View File

@@ -0,0 +1,11 @@
>lcl|BX640419.1_cds_CAE43044.1_2724 [gene=adK] [locus_tag=BP2769] [db_xref=GOA:P0DKX8,InterPro:IPR000850,InterPro:IPR006259,InterPro:IPR007862,InterPro:IPR027417] [protein=adenylate kinase] [protein_id=CAE43044.1] [location=164032..164688] [gbkey=CDS]
ATGCGTCTCATTCTGCTCGGACCGCCCGGAGCCGGCAAAGGCACCCAAGCCGCCTTTCTCACCCAACACT
ACGGCATCCCGCAGATATCCACCGGTGACATGCTGCGCGCCGCCGTCAAGGCCGGCACGCCGCTGGGCCT
GGAAGCCAAGAAGGTCATGGACGCGGGCGGCCTGGTCTCGGACGACCTGATCATCGGCCTGGTGCGCGAT
CGCCTGACCCAGCCCGATTGCGCCAACGGCTACCTGTTCGACGGTTTCCCGCGCACCATCCCGCAGGCCG
ACGCGCTCAAGAGCGCCGGCATCGCGCTGGATTACGTGGTCGAGATCGAAGTGCCGGAAAGCGACATCAT
CGAACGCATGAGCGAACGCCGCGTGCACCCGGCCAGCGGCCGCAGCTACCACGTACGCTTCAATCCGCCC
AAGGCCGAAGGCGTGGACGACGTCACGGGCGAACCGCTGGTGCAGCGCGACGACGACCGCGAGGAAACCG
TGCGCCATCGTCTCAACGTCTACCAGAACCAGACCCGCCCGCTGGTCGACTACTACTCGTCCTGGGCCCA
GTCCGATGCCGCCGCGGCGCCCAAGTACCGCAAGATCTCCGGCGTCGGCTCGGTCGACGAAATCAAGAGC
CGCCTGTCGCAGGCTCTGCAGAGCTAA