Compare commits
53 Commits
0.5.2
...
62ce1c9b2f
| Author | SHA1 | Date | |
|---|---|---|---|
| 62ce1c9b2f | |||
| 7384895578 | |||
| 5a03c7e8d8 | |||
| ddf9cde175 | |||
| 2e8cdd8da9 | |||
| d0318536b2 | |||
| 765cf9d418 | |||
| 348c3d00b4 | |||
| 1c3f7f9ed8 | |||
| e4ddaf2e8c | |||
| 73aade2bde | |||
| af8590baa7 | |||
| 36bca1b70d | |||
| 09a693b696 | |||
| f76bf86ef6 | |||
| a60daf3ee2 | |||
| fbfd993269 | |||
| ba606c35a9 | |||
| 4183840ba0 | |||
| 7fb3eab5b6 | |||
| 175a51f968 | |||
| 897f7ee922 | |||
| bfc286e6b0 | |||
| a88225fcff | |||
| c18d817cd9 | |||
| f462e6d5e0 | |||
| e568e9fb2c | |||
| 4b9eb8674d | |||
| f75707e4fe | |||
| b4845fab34 | |||
| fe999f1cab | |||
| 85946eb110 | |||
| a27e09da31 | |||
| ba2b688e89 | |||
| 49f31b7943 | |||
| 1c6e1cfb35 | |||
| fb99526162 | |||
| ff8a1aff08 | |||
| 341ca933a3 | |||
| 3e3898334f | |||
| ba1f0aa318 | |||
| 6d0157581f | |||
| 4bcbfa0c6a | |||
| ca0f9673b0 | |||
| 5048fa8057 | |||
| 39125c848e | |||
| 744a6c2009 | |||
| 1773bb9dcb | |||
| 1372141b57 | |||
| 677c5e1aa8 | |||
| 53e74af20a | |||
| ade2f3b845 | |||
| c2c6d0b016 |
4
.vscode/launch.json
vendored
4
.vscode/launch.json
vendored
@@ -6,10 +6,10 @@
|
||||
"configurations": [
|
||||
|
||||
{
|
||||
"name": "automlst info -lschema pubmlst_bordetella_seqdef",
|
||||
"name": "autobigs info -lschema pubmlst_bordetella_seqdef",
|
||||
"type": "debugpy",
|
||||
"request": "launch",
|
||||
"program": "${workspaceFolder}/src/automlst/cli/program.py",
|
||||
"program": "${workspaceFolder}/src/autobigs/cli/program.py",
|
||||
"console": "integratedTerminal",
|
||||
"args": [
|
||||
"info",
|
||||
|
||||
4
Jenkinsfile
vendored
4
Jenkinsfile
vendored
@@ -33,10 +33,10 @@ pipeline {
|
||||
parallel {
|
||||
stage ("git.reslate.systems") {
|
||||
environment {
|
||||
TOKEN = credentials('git.reslate.systems')
|
||||
CREDS = credentials('username-password-rs-git')
|
||||
}
|
||||
steps {
|
||||
sh returnStatus: true, script: 'python -m twine upload --repository-url https://git.reslate.systems/api/packages/ydeng/pypi -u __token__ -p ${TOKEN} --non-interactive --disable-progress-bar --verbose dist/*'
|
||||
sh returnStatus: true, script: 'python -m twine upload --repository-url https://git.reslate.systems/api/packages/ydeng/pypi -u ${CREDS_USR} -p ${CREDS_PSW} --non-interactive --disable-progress-bar --verbose dist/*'
|
||||
}
|
||||
}
|
||||
stage ("pypi.org") {
|
||||
|
||||
21
README.md
21
README.md
@@ -1,6 +1,7 @@
|
||||
# autoMLST.Engine
|
||||
# autoBIGS.engine
|
||||
|
||||
A python library implementing common BIGSdb MLST schemes and databases accesses for the purpose of typing sequences automatically. Implementation follows the RESTful API outlined by the official [BIGSdb documentation](https://bigsdb.readthedocs.io/en/latest/rest.html) up to `V1.50.0`.
|
||||
|
||||
A python library implementing common BIGSdb MLST schemes and databases. Implementation follows the RESTful API outlined by the official [BIGSdb documentation](https://bigsdb.readthedocs.io/en/latest/rest.html) up to `V1.50.0`.
|
||||
|
||||
## Features
|
||||
|
||||
@@ -18,8 +19,20 @@ Furthermore, this library is highly asynchronous where any potentially blocking
|
||||
|
||||
This library can be installed through pip. Learn how to [setup and install pip first](https://pip.pypa.io/en/stable/installation/).
|
||||
|
||||
Then, it's as easy as running `pip install automlst-engine` in any terminal that has pip in it's path (any terminal where `pip --version` returns a valid version and install path).
|
||||
Then, it's as easy as running `pip install autobigs-engine` in any terminal that has pip in it's path (any terminal where `pip --version` returns a valid version and install path).
|
||||
|
||||
### CLI usage
|
||||
|
||||
This is a independent python library and thus does not have any form of direct user interface. One way of using it could be to create your own Python script that makes calls to this libraries functions. Alternatively, you may use `automlst-cli`, a `Python` package that implements a CLI for calling this library.
|
||||
This is a independent python library and thus does not have any form of direct user interface. One way of using it could be to create your own Python script that makes calls to this libraries functions. Alternatively, you may use `autobigs-cli`, a `Python` package that implements a CLI for calling this library.
|
||||
|
||||
## Versioning
|
||||
|
||||
the autoBIGS project follows [semantic versioning](https://semver.org/) where the three numbers may be interpreted as MAJOR.MINOR.PATCH.
|
||||
|
||||
Note regarding major version 0 ([spec item 4](https://semver.org/#spec-item-4)), the following adaptation of semantic versioning definition is as follows:
|
||||
|
||||
1. Given x.Y.z, Y is only incremented when a backwards incompatible change is made.
|
||||
|
||||
2. Given x.y.Z, Z is only incremented when a backwards compatible change is made.
|
||||
|
||||
Versions of autoBIGS items with a major version number of 0 will introduce numerous changes and patches. As such, changes between such versions should be considered highly variable.
|
||||
@@ -3,16 +3,22 @@ requires = ["setuptools>=64", "setuptools_scm>=8"]
|
||||
build-backend = "setuptools.build_meta"
|
||||
|
||||
[project]
|
||||
name = "automlst.engine"
|
||||
name = "autoBIGS.engine"
|
||||
dynamic = ["version"]
|
||||
readme = "README.md"
|
||||
|
||||
dependencies = [
|
||||
"biopython",
|
||||
"aiohttp[speedups]",
|
||||
"biopython==1.85",
|
||||
"aiohttp[speedups]==3.11.*",
|
||||
]
|
||||
requires-python = ">=3.11"
|
||||
requires-python = ">=3.12"
|
||||
description = "A library to rapidly fetch fetch MLST profiles given sequences for various diseases."
|
||||
license = {text = "GPL-3.0-or-later"}
|
||||
|
||||
[project.urls]
|
||||
Homepage = "https://github.com/Syph-and-VPD-Lab/autoBIGS.engine"
|
||||
Source = "https://github.com/Syph-and-VPD-Lab/autoBIGS.engine"
|
||||
Issues = "https://github.com/Syph-and-VPD-Lab/autoBIGS.engine/issues"
|
||||
|
||||
[tool.setuptools_scm]
|
||||
|
||||
|
||||
@@ -1,5 +1,5 @@
|
||||
aiohttp[speedups]
|
||||
biopython
|
||||
aiohttp[speedups]==3.11.*
|
||||
biopython==1.85
|
||||
pytest
|
||||
pytest-asyncio
|
||||
build
|
||||
|
||||
206
src/autobigs/engine/analysis/bigsdb.py
Normal file
206
src/autobigs/engine/analysis/bigsdb.py
Normal file
@@ -0,0 +1,206 @@
|
||||
from abc import abstractmethod
|
||||
import asyncio
|
||||
from collections import defaultdict
|
||||
from contextlib import AbstractAsyncContextManager
|
||||
import csv
|
||||
from os import path
|
||||
import os
|
||||
import shutil
|
||||
import tempfile
|
||||
from typing import Any, AsyncGenerator, AsyncIterable, Iterable, Mapping, Sequence, Set, Union
|
||||
|
||||
from aiohttp import ClientSession, ClientTimeout
|
||||
|
||||
from autobigs.engine.reading import read_fasta
|
||||
from autobigs.engine.structures.alignment import PairwiseAlignment
|
||||
from autobigs.engine.structures.genomics import NamedString
|
||||
from autobigs.engine.structures.mlst import Allele, NamedMLSTProfile, AlignmentStats, MLSTProfile
|
||||
from autobigs.engine.exceptions.database import NoBIGSdbExactMatchesException, NoBIGSdbMatchesException, NoSuchBIGSdbDatabaseException
|
||||
|
||||
from Bio.Align import PairwiseAligner
|
||||
|
||||
class BIGSdbMLSTProfiler(AbstractAsyncContextManager):
|
||||
|
||||
@abstractmethod
|
||||
def determine_mlst_allele_variants(self, query_sequence_strings: Iterable[str]) -> AsyncGenerator[Allele, Any]:
|
||||
pass
|
||||
|
||||
@abstractmethod
|
||||
async def determine_mlst_st(self, alleles: Union[AsyncIterable[Allele], Iterable[Allele]]) -> MLSTProfile:
|
||||
pass
|
||||
|
||||
@abstractmethod
|
||||
async def profile_string(self, query_sequence_strings: Iterable[str]) -> MLSTProfile:
|
||||
pass
|
||||
|
||||
@abstractmethod
|
||||
def profile_multiple_strings(self, query_named_string_groups: AsyncIterable[Iterable[NamedString]], stop_on_fail: bool = False) -> AsyncGenerator[NamedMLSTProfile, Any]:
|
||||
pass
|
||||
|
||||
@abstractmethod
|
||||
async def close(self):
|
||||
pass
|
||||
|
||||
class RemoteBIGSdbMLSTProfiler(BIGSdbMLSTProfiler):
|
||||
|
||||
def __init__(self, database_api: str, database_name: str, schema_id: int):
|
||||
self._database_name = database_name
|
||||
self._schema_id = schema_id
|
||||
self._base_url = f"{database_api}/db/{self._database_name}/schemes/{self._schema_id}/"
|
||||
self._http_client = ClientSession(self._base_url, timeout=ClientTimeout(60))
|
||||
|
||||
async def __aenter__(self):
|
||||
return self
|
||||
|
||||
async def determine_mlst_allele_variants(self, query_sequence_strings: Union[Iterable[str], str]) -> AsyncGenerator[Allele, Any]:
|
||||
# See https://bigsdb.pasteur.fr/api/db/pubmlst_bordetella_seqdef/schemes
|
||||
uri_path = "sequence"
|
||||
if isinstance(query_sequence_strings, str):
|
||||
query_sequence_strings = [query_sequence_strings]
|
||||
for sequence_string in query_sequence_strings:
|
||||
async with self._http_client.post(uri_path, json={
|
||||
"sequence": sequence_string,
|
||||
"partial_matches": True
|
||||
}) as response:
|
||||
sequence_response: dict = await response.json()
|
||||
|
||||
if "exact_matches" in sequence_response:
|
||||
# loci -> list of alleles with id and loci
|
||||
exact_matches: dict[str, Sequence[dict[str, str]]] = sequence_response["exact_matches"]
|
||||
for allele_loci, alleles in exact_matches.items():
|
||||
for allele in alleles:
|
||||
alelle_id = allele["allele_id"]
|
||||
yield Allele(allele_locus=allele_loci, allele_variant=alelle_id, partial_match_profile=None)
|
||||
elif "partial_matches" in sequence_response:
|
||||
partial_matches: dict[str, dict[str, Union[str, float, int]]] = sequence_response["partial_matches"]
|
||||
for allele_loci, partial_match in partial_matches.items():
|
||||
if len(partial_match) <= 0:
|
||||
continue
|
||||
partial_match_profile = AlignmentStats(
|
||||
percent_identity=float(partial_match["identity"]),
|
||||
mismatches=int(partial_match["mismatches"]),
|
||||
gaps=int(partial_match["gaps"]),
|
||||
match_metric=int(partial_match["bitscore"])
|
||||
)
|
||||
yield Allele(
|
||||
allele_locus=allele_loci,
|
||||
allele_variant=str(partial_match["allele"]),
|
||||
partial_match_profile=partial_match_profile
|
||||
)
|
||||
else:
|
||||
raise NoBIGSdbMatchesException(self._database_name, self._schema_id)
|
||||
|
||||
async def determine_mlst_st(self, alleles: Union[AsyncIterable[Allele], Iterable[Allele]]) -> MLSTProfile:
|
||||
uri_path = "designations"
|
||||
allele_request_dict: dict[str, list[dict[str, str]]] = defaultdict(list)
|
||||
if isinstance(alleles, AsyncIterable):
|
||||
async for allele in alleles:
|
||||
allele_request_dict[allele.allele_locus].append({"allele": str(allele.allele_variant)})
|
||||
else:
|
||||
for allele in alleles:
|
||||
allele_request_dict[allele.allele_locus].append({"allele": str(allele.allele_variant)})
|
||||
request_json = {
|
||||
"designations": allele_request_dict
|
||||
}
|
||||
async with self._http_client.post(uri_path, json=request_json) as response:
|
||||
response_json: dict = await response.json()
|
||||
allele_set: Set[Allele] = set()
|
||||
response_json.setdefault("fields", dict())
|
||||
schema_fields_returned: dict[str, str] = response_json["fields"]
|
||||
schema_fields_returned.setdefault("ST", "unknown")
|
||||
schema_fields_returned.setdefault("clonal_complex", "unknown")
|
||||
schema_exact_matches: dict = response_json["exact_matches"]
|
||||
for exact_match_locus, exact_match_alleles in schema_exact_matches.items():
|
||||
if len(exact_match_alleles) > 1:
|
||||
raise ValueError(f"Unexpected number of alleles returned for exact match (Expected 1, retrieved {len(exact_match_alleles)})")
|
||||
allele_set.add(Allele(exact_match_locus, exact_match_alleles[0]["allele_id"], None))
|
||||
if len(allele_set) == 0:
|
||||
raise ValueError("Passed in no alleles.")
|
||||
return MLSTProfile(allele_set, schema_fields_returned["ST"], schema_fields_returned["clonal_complex"])
|
||||
|
||||
async def profile_string(self, query_sequence_strings: Iterable[str]) -> MLSTProfile:
|
||||
alleles = self.determine_mlst_allele_variants(query_sequence_strings)
|
||||
return await self.determine_mlst_st(alleles)
|
||||
|
||||
async def profile_multiple_strings(self, query_named_string_groups: AsyncIterable[Iterable[NamedString]], stop_on_fail: bool = False) -> AsyncGenerator[NamedMLSTProfile, Any]:
|
||||
async for named_strings in query_named_string_groups:
|
||||
names: list[str] = list()
|
||||
sequences: list[str] = list()
|
||||
for named_string in named_strings:
|
||||
names.append(named_string.name)
|
||||
sequences.append(named_string.sequence)
|
||||
try:
|
||||
yield NamedMLSTProfile("-".join(names), (await self.profile_string(sequences)))
|
||||
except NoBIGSdbMatchesException as e:
|
||||
if stop_on_fail:
|
||||
raise e
|
||||
yield NamedMLSTProfile("-".join(names), None)
|
||||
|
||||
async def close(self):
|
||||
await self._http_client.close()
|
||||
|
||||
async def __aexit__(self, exc_type, exc_value, traceback):
|
||||
await self.close()
|
||||
|
||||
class BIGSdbIndex(AbstractAsyncContextManager):
|
||||
KNOWN_BIGSDB_APIS = {
|
||||
"https://bigsdb.pasteur.fr/api",
|
||||
"https://rest.pubmlst.org"
|
||||
}
|
||||
|
||||
def __init__(self):
|
||||
self._http_client = ClientSession()
|
||||
self._known_seqdef_dbs_origin: Union[Mapping[str, str], None] = None
|
||||
self._seqdefdb_schemas: dict[str, Union[Mapping[str, int], None]] = dict()
|
||||
super().__init__()
|
||||
|
||||
async def __aenter__(self):
|
||||
return self
|
||||
|
||||
async def get_known_seqdef_dbs(self, force: bool = False) -> Mapping[str, str]:
|
||||
if self._known_seqdef_dbs_origin is not None and not force:
|
||||
return self._known_seqdef_dbs_origin
|
||||
known_seqdef_dbs = dict()
|
||||
for known_bigsdb in BIGSdbIndex.KNOWN_BIGSDB_APIS:
|
||||
async with self._http_client.get(f"{known_bigsdb}/db") as response:
|
||||
response_json_databases = await response.json()
|
||||
for database_group in response_json_databases:
|
||||
for database_info in database_group["databases"]:
|
||||
if str(database_info["name"]).endswith("seqdef"):
|
||||
known_seqdef_dbs[database_info["name"]] = known_bigsdb
|
||||
self._known_seqdef_dbs_origin = dict(known_seqdef_dbs)
|
||||
return self._known_seqdef_dbs_origin
|
||||
|
||||
async def get_bigsdb_api_from_seqdefdb(self, seqdef_db_name: str) -> str:
|
||||
known_databases = await self.get_known_seqdef_dbs()
|
||||
if seqdef_db_name not in known_databases:
|
||||
raise NoSuchBIGSdbDatabaseException(seqdef_db_name)
|
||||
return known_databases[seqdef_db_name]
|
||||
|
||||
async def get_schemas_for_seqdefdb(self, seqdef_db_name: str, force: bool = False) -> Mapping[str, int]:
|
||||
if seqdef_db_name in self._seqdefdb_schemas and not force:
|
||||
return self._seqdefdb_schemas[seqdef_db_name] # type: ignore since it's guaranteed to not be none by conditional
|
||||
uri_path = f"{await self.get_bigsdb_api_from_seqdefdb(seqdef_db_name)}/db/{seqdef_db_name}/schemes"
|
||||
async with self._http_client.get(uri_path) as response:
|
||||
response_json = await response.json()
|
||||
schema_descriptions: Mapping[str, int] = dict()
|
||||
for scheme_definition in response_json["schemes"]:
|
||||
scheme_id: int = int(str(scheme_definition["scheme"]).split("/")[-1])
|
||||
scheme_desc: str = scheme_definition["description"]
|
||||
schema_descriptions[scheme_desc] = scheme_id
|
||||
self._seqdefdb_schemas[seqdef_db_name] = schema_descriptions
|
||||
return self._seqdefdb_schemas[seqdef_db_name] # type: ignore
|
||||
|
||||
async def build_profiler_from_seqdefdb(self, local: bool, dbseqdef_name: str, schema_id: int) -> BIGSdbMLSTProfiler:
|
||||
return get_BIGSdb_MLST_profiler(local, await self.get_bigsdb_api_from_seqdefdb(dbseqdef_name), dbseqdef_name, schema_id)
|
||||
|
||||
async def close(self):
|
||||
await self._http_client.close()
|
||||
|
||||
async def __aexit__(self, exc_type, exc_value, traceback):
|
||||
await self.close()
|
||||
|
||||
def get_BIGSdb_MLST_profiler(local: bool, database_api: str, database_name: str, schema_id: int):
|
||||
if local:
|
||||
raise NotImplementedError()
|
||||
return RemoteBIGSdbMLSTProfiler(database_api=database_api, database_name=database_name, schema_id=schema_id)
|
||||
17
src/autobigs/engine/reading.py
Normal file
17
src/autobigs/engine/reading.py
Normal file
@@ -0,0 +1,17 @@
|
||||
import asyncio
|
||||
from io import TextIOWrapper
|
||||
from typing import Any, AsyncGenerator, Iterable, Union
|
||||
from Bio import SeqIO
|
||||
|
||||
from autobigs.engine.structures.genomics import NamedString
|
||||
|
||||
async def read_fasta(handle: Union[str, TextIOWrapper]) -> Iterable[NamedString]:
|
||||
fasta_sequences = asyncio.to_thread(SeqIO.parse, handle=handle, format="fasta")
|
||||
results = []
|
||||
for fasta_sequence in await fasta_sequences:
|
||||
results.append(NamedString(fasta_sequence.id, str(fasta_sequence.seq)))
|
||||
return results
|
||||
|
||||
async def read_multiple_fastas(handles: Iterable[Union[str, TextIOWrapper]]) -> AsyncGenerator[Iterable[NamedString], Any]:
|
||||
for handle in handles:
|
||||
yield await read_fasta(handle)
|
||||
18
src/autobigs/engine/structures/alignment.py
Normal file
18
src/autobigs/engine/structures/alignment.py
Normal file
@@ -0,0 +1,18 @@
|
||||
from dataclasses import dataclass
|
||||
from numbers import Number
|
||||
from typing import Sequence
|
||||
|
||||
@dataclass(frozen=True)
|
||||
class AlignmentStats:
|
||||
percent_identity: float
|
||||
mismatches: int
|
||||
gaps: int
|
||||
match_metric: int
|
||||
|
||||
@dataclass(frozen=True)
|
||||
class PairwiseAlignment:
|
||||
reference: str
|
||||
query: str
|
||||
reference_indices: Sequence[Number]
|
||||
query_indices: Sequence[Number]
|
||||
alignment_stats: AlignmentStats
|
||||
33
src/autobigs/engine/structures/mlst.py
Normal file
33
src/autobigs/engine/structures/mlst.py
Normal file
@@ -0,0 +1,33 @@
|
||||
from collections import defaultdict
|
||||
from dataclasses import dataclass
|
||||
from typing import Collection, Iterable, Mapping, Sequence, Union
|
||||
|
||||
from autobigs.engine.structures.alignment import AlignmentStats
|
||||
|
||||
@dataclass(frozen=True)
|
||||
class Allele:
|
||||
allele_locus: str
|
||||
allele_variant: str
|
||||
partial_match_profile: Union[None, AlignmentStats]
|
||||
|
||||
@dataclass(frozen=True)
|
||||
class MLSTProfile:
|
||||
alleles: Collection[Allele]
|
||||
sequence_type: str
|
||||
clonal_complex: str
|
||||
|
||||
@dataclass(frozen=True)
|
||||
class NamedMLSTProfile:
|
||||
name: str
|
||||
mlst_profile: Union[None, MLSTProfile]
|
||||
|
||||
|
||||
def alleles_to_mapping(alleles: Iterable[Allele]):
|
||||
result = defaultdict(list)
|
||||
for allele in alleles:
|
||||
result[allele.allele_locus].append(allele.allele_variant)
|
||||
result = dict(result)
|
||||
for locus, variant in result.items():
|
||||
if len(variant) == 1:
|
||||
result[locus] = variant[0]
|
||||
return result
|
||||
43
src/autobigs/engine/writing.py
Normal file
43
src/autobigs/engine/writing.py
Normal file
@@ -0,0 +1,43 @@
|
||||
from collections import defaultdict
|
||||
import csv
|
||||
from os import PathLike
|
||||
from typing import AsyncIterable, Collection, Mapping, Sequence, Union
|
||||
|
||||
from autobigs.engine.structures.mlst import Allele, MLSTProfile, NamedMLSTProfile
|
||||
|
||||
|
||||
def alleles_to_text_map(alleles: Collection[Allele]) -> Mapping[str, Union[Sequence[str], str]]:
|
||||
result = defaultdict(list)
|
||||
for allele in alleles:
|
||||
result[allele.allele_locus].append(allele.allele_variant + ("*" if allele.partial_match_profile is not None else ""))
|
||||
for locus in result.keys():
|
||||
if len(result[locus]) == 1:
|
||||
result[locus] = result[locus][0] # Take the only one
|
||||
else:
|
||||
result[locus] = tuple(result[locus]) # type: ignore
|
||||
return dict(result)
|
||||
|
||||
async def write_mlst_profiles_as_csv(mlst_profiles_iterable: AsyncIterable[NamedMLSTProfile], handle: Union[str, bytes, PathLike[str], PathLike[bytes]]) -> Sequence[str]:
|
||||
failed = list()
|
||||
with open(handle, "w", newline='') as filehandle:
|
||||
header = None
|
||||
writer: Union[csv.DictWriter, None] = None
|
||||
async for named_mlst_profile in mlst_profiles_iterable:
|
||||
name = named_mlst_profile.name
|
||||
mlst_profile = named_mlst_profile.mlst_profile
|
||||
if mlst_profile is None:
|
||||
failed.append(name)
|
||||
continue
|
||||
allele_mapping = alleles_to_text_map(mlst_profile.alleles)
|
||||
if writer is None:
|
||||
header = ["id", "st", "clonal-complex", *sorted(allele_mapping.keys())]
|
||||
writer = csv.DictWriter(filehandle, fieldnames=header)
|
||||
writer.writeheader()
|
||||
row_dictionary = {
|
||||
"st": mlst_profile.sequence_type,
|
||||
"clonal-complex": mlst_profile.clonal_complex,
|
||||
"id": name,
|
||||
**allele_mapping
|
||||
}
|
||||
writer.writerow(rowdict=row_dictionary)
|
||||
return failed
|
||||
@@ -1,41 +0,0 @@
|
||||
import csv
|
||||
from os import PathLike
|
||||
from typing import AsyncIterable, Mapping, Sequence, Union
|
||||
|
||||
from automlst.engine.data.structures.mlst import Allele, MLSTProfile
|
||||
|
||||
|
||||
def dict_loci_alleles_variants_from_loci(alleles_map: Mapping[str, Sequence[Allele]]):
|
||||
result_dict: dict[str, Union[list[str], str]] = {}
|
||||
for loci, alleles in alleles_map.items():
|
||||
if len(alleles) == 1:
|
||||
result_dict[loci] = alleles[0].allele_variant
|
||||
else:
|
||||
result_locis = list()
|
||||
for allele in alleles:
|
||||
result_locis.append(allele.allele_variant)
|
||||
result_dict[loci] = result_locis
|
||||
return result_dict
|
||||
|
||||
|
||||
async def write_mlst_profiles_as_csv(mlst_profiles_iterable: AsyncIterable[tuple[str, Union[MLSTProfile, None]]], handle: Union[str, bytes, PathLike[str], PathLike[bytes]]) -> Sequence[str]:
|
||||
failed = list()
|
||||
with open(handle, "w", newline='') as filehandle:
|
||||
header = None
|
||||
writer: Union[csv.DictWriter, None] = None
|
||||
async for name, mlst_profile in mlst_profiles_iterable:
|
||||
if mlst_profile is None:
|
||||
failed.append(name)
|
||||
continue
|
||||
if writer is None:
|
||||
header = ["id", "st", "clonal-complex", *mlst_profile.alleles.keys()]
|
||||
writer = csv.DictWriter(filehandle, fieldnames=header)
|
||||
writer.writeheader()
|
||||
row_dictionary = {
|
||||
"st": mlst_profile.sequence_type,
|
||||
"clonal-complex": mlst_profile.clonal_complex,
|
||||
"id": name,
|
||||
**dict_loci_alleles_variants_from_loci(mlst_profile.alleles)
|
||||
}
|
||||
writer.writerow(rowdict=row_dictionary)
|
||||
return failed
|
||||
@@ -1,16 +0,0 @@
|
||||
import asyncio
|
||||
from io import TextIOWrapper
|
||||
from typing import Any, AsyncGenerator, Generator, Iterable, Sequence, Union
|
||||
from Bio import SeqIO
|
||||
|
||||
from automlst.engine.data.structures.genomics import NamedString
|
||||
|
||||
async def read_fasta(handle: Union[str, TextIOWrapper]) -> AsyncGenerator[NamedString, Any]:
|
||||
fasta_sequences = asyncio.to_thread(SeqIO.parse, handle=handle, format="fasta")
|
||||
for fasta_sequence in await fasta_sequences:
|
||||
yield NamedString(fasta_sequence.id, str(fasta_sequence.seq))
|
||||
|
||||
async def read_multiple_fastas(handles: Iterable[Union[str, TextIOWrapper]]) -> AsyncGenerator[NamedString, Any]:
|
||||
for handle in handles:
|
||||
async for named_seq in read_fasta(handle):
|
||||
yield named_seq
|
||||
@@ -1,166 +0,0 @@
|
||||
from collections import defaultdict
|
||||
from contextlib import AbstractAsyncContextManager
|
||||
from numbers import Number
|
||||
from typing import Any, AsyncGenerator, AsyncIterable, Collection, Generator, Iterable, Mapping, Sequence, Union
|
||||
|
||||
from aiohttp import ClientSession, ClientTimeout
|
||||
|
||||
from automlst.engine.data.structures.genomics import NamedString
|
||||
from automlst.engine.data.structures.mlst import Allele, PartialAllelicMatchProfile, MLSTProfile
|
||||
from automlst.engine.exceptions.database import NoBIGSdbExactMatchesException, NoBIGSdbMatchesException, NoSuchBIGSdbDatabaseException
|
||||
|
||||
class BIGSdbMLSTProfiler(AbstractAsyncContextManager):
|
||||
|
||||
def __init__(self, database_api: str, database_name: str, schema_id: int):
|
||||
self._database_name = database_name
|
||||
self._schema_id = schema_id
|
||||
self._base_url = f"{database_api}/db/{self._database_name}/schemes/{self._schema_id}/"
|
||||
self._http_client = ClientSession(self._base_url, timeout=ClientTimeout(10000))
|
||||
|
||||
async def __aenter__(self):
|
||||
return self
|
||||
|
||||
async def fetch_mlst_allele_variants(self, sequence_string: str, exact: bool) -> AsyncGenerator[Allele, Any]:
|
||||
# See https://bigsdb.pasteur.fr/api/db/pubmlst_bordetella_seqdef/schemes
|
||||
uri_path = "sequence"
|
||||
response = await self._http_client.post(uri_path, json={
|
||||
"sequence": sequence_string,
|
||||
"partial_matches": not exact
|
||||
})
|
||||
sequence_response: dict = await response.json()
|
||||
|
||||
if "exact_matches" in sequence_response:
|
||||
# loci -> list of alleles with id and loci
|
||||
exact_matches: dict[str, Sequence[dict[str, str]]] = sequence_response["exact_matches"]
|
||||
for allele_loci, alleles in exact_matches.items():
|
||||
for allele in alleles:
|
||||
alelle_id = allele["allele_id"]
|
||||
yield Allele(allele_loci=allele_loci, allele_variant=alelle_id, partial_match_profile=None)
|
||||
elif "partial_matches" in sequence_response:
|
||||
if exact:
|
||||
raise NoBIGSdbExactMatchesException(self._database_name, self._schema_id)
|
||||
partial_matches: dict[str, dict[str, Union[str, float, int]]] = sequence_response["partial_matches"]
|
||||
for allele_loci, partial_match in partial_matches.items():
|
||||
if len(partial_match) <= 0:
|
||||
continue
|
||||
partial_match_profile = PartialAllelicMatchProfile(
|
||||
percent_identity=float(partial_match["identity"]),
|
||||
mismatches=int(partial_match["mismatches"]),
|
||||
bitscore=float(partial_match["bitscore"]),
|
||||
gaps=int(partial_match["gaps"])
|
||||
)
|
||||
yield Allele(
|
||||
allele_loci=allele_loci,
|
||||
allele_variant=str(partial_match["allele"]),
|
||||
partial_match_profile=partial_match_profile
|
||||
)
|
||||
else:
|
||||
raise NoBIGSdbMatchesException(self._database_name, self._schema_id)
|
||||
|
||||
|
||||
|
||||
async def fetch_mlst_st(self, alleles: Union[AsyncIterable[Allele], Iterable[Allele]]) -> MLSTProfile:
|
||||
uri_path = "designations"
|
||||
allele_request_dict: dict[str, list[dict[str, str]]] = defaultdict(list)
|
||||
if isinstance(alleles, AsyncIterable):
|
||||
async for allele in alleles:
|
||||
allele_request_dict[allele.allele_loci].append({"allele": str(allele.allele_variant)})
|
||||
else:
|
||||
for allele in alleles:
|
||||
allele_request_dict[allele.allele_loci].append({"allele": str(allele.allele_variant)})
|
||||
request_json = {
|
||||
"designations": allele_request_dict
|
||||
}
|
||||
async with self._http_client.post(uri_path, json=request_json) as response:
|
||||
response_json: dict = await response.json()
|
||||
allele_map: dict[str, list[Allele]] = defaultdict(list)
|
||||
response_json.setdefault("fields", dict())
|
||||
schema_fields_returned: dict[str, str] = response_json["fields"]
|
||||
schema_fields_returned.setdefault("ST", "unknown")
|
||||
schema_fields_returned.setdefault("clonal_complex", "unknown")
|
||||
schema_exact_matches: dict = response_json["exact_matches"]
|
||||
for exact_match_loci, exact_match_alleles in schema_exact_matches.items():
|
||||
for exact_match_allele in exact_match_alleles:
|
||||
allele_map[exact_match_loci].append(Allele(exact_match_loci, exact_match_allele["allele_id"], None))
|
||||
if len(allele_map) == 0:
|
||||
raise ValueError("Passed in no alleles.")
|
||||
return MLSTProfile(dict(allele_map), schema_fields_returned["ST"], schema_fields_returned["clonal_complex"])
|
||||
|
||||
async def profile_string(self, string: str, exact: bool = False) -> MLSTProfile:
|
||||
alleles = self.fetch_mlst_allele_variants(string, exact)
|
||||
return await self.fetch_mlst_st(alleles)
|
||||
|
||||
|
||||
async def profile_multiple_strings(self, namedStrings: AsyncIterable[NamedString], exact: bool = False, stop_on_fail: bool = False) -> AsyncGenerator[tuple[str, Union[MLSTProfile, None]], Any]:
|
||||
async for named_string in namedStrings:
|
||||
try:
|
||||
yield (named_string.name, await self.profile_string(named_string.sequence, exact))
|
||||
except NoBIGSdbMatchesException as e:
|
||||
if stop_on_fail:
|
||||
raise e
|
||||
yield (named_string.name, None)
|
||||
|
||||
async def close(self):
|
||||
await self._http_client.close()
|
||||
|
||||
async def __aexit__(self, exc_type, exc_value, traceback):
|
||||
await self.close()
|
||||
|
||||
class BIGSdbIndex(AbstractAsyncContextManager):
|
||||
KNOWN_BIGSDB_APIS = {
|
||||
"https://bigsdb.pasteur.fr/api",
|
||||
"https://rest.pubmlst.org"
|
||||
}
|
||||
|
||||
def __init__(self):
|
||||
self._http_client = ClientSession()
|
||||
self._known_seqdef_dbs_origin: Union[Mapping[str, str], None] = None
|
||||
self._seqdefdb_schemas: dict[str, Union[Mapping[str, int], None]] = dict()
|
||||
super().__init__()
|
||||
|
||||
async def __aenter__(self):
|
||||
return self
|
||||
|
||||
async def get_known_seqdef_dbs(self, force: bool = False) -> Mapping[str, str]:
|
||||
if self._known_seqdef_dbs_origin is not None and not force:
|
||||
return self._known_seqdef_dbs_origin
|
||||
known_seqdef_dbs = dict()
|
||||
for known_bigsdb in BIGSdbIndex.KNOWN_BIGSDB_APIS:
|
||||
async with self._http_client.get(f"{known_bigsdb}/db") as response:
|
||||
response_json_databases = await response.json()
|
||||
for database_group in response_json_databases:
|
||||
for database_info in database_group["databases"]:
|
||||
if str(database_info["name"]).endswith("seqdef"):
|
||||
known_seqdef_dbs[database_info["name"]] = known_bigsdb
|
||||
self._known_seqdef_dbs_origin = dict(known_seqdef_dbs)
|
||||
return self._known_seqdef_dbs_origin
|
||||
|
||||
async def get_bigsdb_api_from_seqdefdb(self, seqdef_db_name: str) -> str:
|
||||
known_databases = await self.get_known_seqdef_dbs()
|
||||
if seqdef_db_name not in known_databases:
|
||||
raise NoSuchBIGSdbDatabaseException(seqdef_db_name)
|
||||
return known_databases[seqdef_db_name]
|
||||
|
||||
async def get_schemas_for_seqdefdb(self, seqdef_db_name: str, force: bool = False) -> Mapping[str, int]:
|
||||
if seqdef_db_name in self._seqdefdb_schemas and not force:
|
||||
return self._seqdefdb_schemas[seqdef_db_name] # type: ignore since it's guaranteed to not be none by conditional
|
||||
uri_path = f"{await self.get_bigsdb_api_from_seqdefdb(seqdef_db_name)}/db/{seqdef_db_name}/schemes"
|
||||
async with self._http_client.get(uri_path) as response:
|
||||
response_json = await response.json()
|
||||
schema_descriptions: Mapping[str, int] = dict()
|
||||
for scheme_definition in response_json["schemes"]:
|
||||
scheme_id: int = int(str(scheme_definition["scheme"]).split("/")[-1])
|
||||
scheme_desc: str = scheme_definition["description"]
|
||||
schema_descriptions[scheme_desc] = scheme_id
|
||||
self._seqdefdb_schemas[seqdef_db_name] = schema_descriptions
|
||||
return self._seqdefdb_schemas[seqdef_db_name] # type: ignore
|
||||
|
||||
async def build_profiler_from_seqdefdb(self, dbseqdef_name: str, schema_id: int) -> BIGSdbMLSTProfiler:
|
||||
return BIGSdbMLSTProfiler(await self.get_bigsdb_api_from_seqdefdb(dbseqdef_name), dbseqdef_name, schema_id)
|
||||
|
||||
async def close(self):
|
||||
await self._http_client.close()
|
||||
|
||||
async def __aexit__(self, exc_type, exc_value, traceback):
|
||||
await self.close()
|
||||
|
||||
@@ -1,21 +0,0 @@
|
||||
from dataclasses import dataclass
|
||||
from typing import Mapping, Sequence, Union
|
||||
|
||||
@dataclass(frozen=True)
|
||||
class PartialAllelicMatchProfile:
|
||||
percent_identity: float
|
||||
mismatches: int
|
||||
bitscore: float
|
||||
gaps: int
|
||||
|
||||
@dataclass(frozen=True)
|
||||
class Allele:
|
||||
allele_loci: str
|
||||
allele_variant: str
|
||||
partial_match_profile: Union[None, PartialAllelicMatchProfile]
|
||||
|
||||
@dataclass(frozen=True)
|
||||
class MLSTProfile:
|
||||
alleles: Mapping[str, Sequence[Allele]]
|
||||
sequence_type: str
|
||||
clonal_complex: str
|
||||
211
tests/autobigs/engine/analysis/test_bigsdb.py
Normal file
211
tests/autobigs/engine/analysis/test_bigsdb.py
Normal file
@@ -0,0 +1,211 @@
|
||||
from os import path
|
||||
import random
|
||||
import re
|
||||
from typing import Callable, Collection, Sequence, Union
|
||||
from Bio import SeqIO
|
||||
import pytest
|
||||
from autobigs.engine.analysis import bigsdb
|
||||
from autobigs.engine.structures import mlst
|
||||
from autobigs.engine.structures.genomics import NamedString
|
||||
from autobigs.engine.structures.mlst import Allele, MLSTProfile
|
||||
from autobigs.engine.exceptions.database import NoBIGSdbExactMatchesException, NoBIGSdbMatchesException
|
||||
from autobigs.engine.analysis.bigsdb import BIGSdbIndex, BIGSdbMLSTProfiler, RemoteBIGSdbMLSTProfiler
|
||||
|
||||
async def generate_async_iterable(normal_iterable):
|
||||
for dummy_sequence in normal_iterable:
|
||||
yield dummy_sequence
|
||||
|
||||
def gene_scrambler(gene: str, mutation_site_count: Union[int, float], alphabet: Sequence[str] = ["A", "T", "C", "G"]):
|
||||
rand = random.Random(gene)
|
||||
if isinstance(mutation_site_count, float):
|
||||
mutation_site_count = int(mutation_site_count * len(gene))
|
||||
random_locations = rand.choices(range(len(gene)), k=mutation_site_count)
|
||||
scrambled = list(gene)
|
||||
for random_location in random_locations:
|
||||
scrambled[random_location] = rand.choice(alphabet)
|
||||
return "".join(scrambled)
|
||||
|
||||
def get_first_sequence_from_fasta(resource: str):
|
||||
return str(SeqIO.read(path.join("tests/resources/", resource), "fasta").seq)
|
||||
|
||||
def get_multiple_sequences_from_fasta(resource: str):
|
||||
return tuple(SeqIO.parse(path.join("tests/resources/", resource), "fasta"))
|
||||
|
||||
bpertussis_tohamaI_profile = MLSTProfile((
|
||||
Allele("adk", "1", None),
|
||||
Allele("fumC", "1", None),
|
||||
Allele("glyA", "1", None),
|
||||
Allele("tyrB", "1", None),
|
||||
Allele("icd", "1", None),
|
||||
Allele("pepA", "1", None),
|
||||
Allele("pgm", "1", None)), "1", "ST-2 complex")
|
||||
|
||||
bpertussis_tohamaI_bad_profile = MLSTProfile((
|
||||
Allele("adk", "1", None),
|
||||
Allele("fumC", "2", None),
|
||||
Allele("glyA", "36", None),
|
||||
Allele("tyrB", "4", None),
|
||||
Allele("icd", "4", None),
|
||||
Allele("pepA", "1", None),
|
||||
Allele("pgm", "5", None),
|
||||
), "unknown", "unknown")
|
||||
|
||||
hinfluenzae_2014_102_profile = MLSTProfile((
|
||||
Allele("adk", "28", None),
|
||||
Allele("atpG", "33", None),
|
||||
Allele("frdB", "7", None),
|
||||
Allele("fucK", "18", None),
|
||||
Allele("mdh", "11", None),
|
||||
Allele("pgi", "125", None),
|
||||
Allele("recA", "89", None)
|
||||
), "478", "unknown")
|
||||
|
||||
hinfluenzae_2014_102_bad_profile = MLSTProfile((
|
||||
Allele("adk", "3", None),
|
||||
Allele("atpG", "121", None),
|
||||
Allele("frdB", "6", None),
|
||||
Allele("fucK", "5", None),
|
||||
Allele("mdh", "12", None),
|
||||
Allele("pgi", "4", None),
|
||||
Allele("recA", "5", None)
|
||||
), "unknown", "unknown")
|
||||
|
||||
|
||||
@pytest.mark.parametrize("local_db,database_api,database_name,schema_id,seq_path,feature_seqs_path,expected_profile,bad_profile", [
|
||||
(False, "https://bigsdb.pasteur.fr/api", "pubmlst_bordetella_seqdef", 3, "tohama_I_bpertussis.fasta", "tohama_I_bpertussis_features.fasta", bpertussis_tohamaI_profile, bpertussis_tohamaI_bad_profile),
|
||||
(False, "https://rest.pubmlst.org", "pubmlst_hinfluenzae_seqdef", 1, "2014-102_hinfluenza.fasta", "2014-102_hinfluenza_features.fasta", hinfluenzae_2014_102_profile, hinfluenzae_2014_102_bad_profile),
|
||||
])
|
||||
class TestBIGSdbMLSTProfiler:
|
||||
async def test_profiling_results_in_exact_matches_when_exact(self, local_db, database_api, database_name, schema_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
|
||||
sequence = get_first_sequence_from_fasta(seq_path)
|
||||
async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, schema_id) as dummy_profiler:
|
||||
expected_alleles = mlst.alleles_to_mapping(expected_profile.alleles)
|
||||
targets_left = set(mlst.alleles_to_mapping(expected_profile.alleles).keys())
|
||||
async for exact_match in dummy_profiler.determine_mlst_allele_variants(query_sequence_strings=[sequence]):
|
||||
assert isinstance(exact_match, Allele)
|
||||
assert exact_match.allele_locus in expected_alleles
|
||||
assert exact_match.allele_variant == expected_alleles[exact_match.allele_locus]
|
||||
targets_left.remove(exact_match.allele_locus)
|
||||
|
||||
assert len(targets_left) == 0
|
||||
|
||||
async def test_sequence_profiling_non_exact_returns_non_exact(self, local_db, database_api, database_name, schema_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
|
||||
target_sequences = get_multiple_sequences_from_fasta(feature_seqs_path)
|
||||
mlst_targets = {x.lower() for x in mlst.alleles_to_mapping(expected_profile.alleles).keys()}
|
||||
async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, schema_id) as profiler:
|
||||
for target_sequence in target_sequences:
|
||||
match = re.fullmatch(r".*\[gene=([\w\d]+)\].*", target_sequence.description)
|
||||
if match is None:
|
||||
continue
|
||||
gene = match.group(1).lower()
|
||||
if gene not in mlst_targets:
|
||||
continue
|
||||
scrambled = gene_scrambler(str(target_sequence.seq), 0.125)
|
||||
async for partial_match in profiler.determine_mlst_allele_variants([scrambled]):
|
||||
assert partial_match.partial_match_profile is not None
|
||||
mlst_targets.remove(gene)
|
||||
|
||||
assert len(mlst_targets) == 0
|
||||
|
||||
async def test_profiling_results_in_correct_mlst_st(self, local_db, database_api, database_name, schema_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
|
||||
async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, schema_id) as dummy_profiler:
|
||||
mlst_st_data = await dummy_profiler.determine_mlst_st(expected_profile.alleles)
|
||||
assert mlst_st_data is not None
|
||||
assert isinstance(mlst_st_data, MLSTProfile)
|
||||
assert mlst_st_data.clonal_complex == expected_profile.clonal_complex
|
||||
assert mlst_st_data.sequence_type == expected_profile.sequence_type
|
||||
|
||||
async def test_profiling_non_exact_results_in_list_of_mlsts(self, local_db, database_api, database_name, schema_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
|
||||
dummy_alleles = bad_profile.alleles
|
||||
async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, schema_id) as dummy_profiler:
|
||||
mlst_profile = await dummy_profiler.determine_mlst_st(dummy_alleles)
|
||||
assert mlst_profile.clonal_complex == "unknown"
|
||||
assert mlst_profile.sequence_type == "unknown"
|
||||
|
||||
|
||||
async def test_bigsdb_profile_multiple_strings_same_string_twice(self, local_db, database_api, database_name, schema_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
|
||||
sequence = get_first_sequence_from_fasta(seq_path)
|
||||
dummy_sequences = [[NamedString("seq1", sequence)], [NamedString("seq2", sequence)]]
|
||||
async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, schema_id) as dummy_profiler:
|
||||
async for named_profile in dummy_profiler.profile_multiple_strings(generate_async_iterable(dummy_sequences)):
|
||||
name, profile = named_profile.name, named_profile.mlst_profile
|
||||
assert profile is not None
|
||||
assert isinstance(profile, MLSTProfile)
|
||||
assert profile.clonal_complex == expected_profile.clonal_complex
|
||||
assert profile.sequence_type == expected_profile.sequence_type
|
||||
|
||||
async def test_bigsdb_profile_multiple_strings_exactmatch_fail_second_no_stop(self, local_db, database_api, database_name, schema_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
|
||||
valid_seq = get_first_sequence_from_fasta(seq_path)
|
||||
dummy_sequences = [[NamedString("seq1", valid_seq)], [NamedString("should_fail", gene_scrambler(valid_seq, 0.3))], [NamedString("seq3", valid_seq)]]
|
||||
async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, schema_id) as dummy_profiler:
|
||||
async for name_profile in dummy_profiler.profile_multiple_strings(generate_async_iterable(dummy_sequences), True):
|
||||
name, profile = name_profile.name, name_profile.mlst_profile
|
||||
|
||||
assert profile is not None
|
||||
if name == "should_fail":
|
||||
assert profile.clonal_complex == "unknown"
|
||||
assert profile.sequence_type == "unknown"
|
||||
assert len(profile.alleles) > 0
|
||||
else:
|
||||
assert isinstance(profile, MLSTProfile)
|
||||
assert profile.clonal_complex == expected_profile.clonal_complex
|
||||
assert profile.sequence_type == expected_profile.sequence_type
|
||||
|
||||
async def test_bigsdb_profile_multiple_strings_nonexact_second_no_stop(self, local_db, database_api, database_name, schema_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
|
||||
valid_seq = get_first_sequence_from_fasta(seq_path)
|
||||
dummy_sequences = [[NamedString("seq1", valid_seq)], [NamedString("should_fail", gene_scrambler(valid_seq, 0.3))], [NamedString("seq3", valid_seq)]]
|
||||
|
||||
async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, schema_id) as dummy_profiler:
|
||||
async for named_profile in dummy_profiler.profile_multiple_strings(generate_async_iterable(dummy_sequences), False):
|
||||
name, profile = named_profile.name, named_profile.mlst_profile
|
||||
|
||||
assert profile is not None
|
||||
if name == "should_fail":
|
||||
assert profile.clonal_complex == "unknown"
|
||||
assert profile.sequence_type == "unknown"
|
||||
assert len(profile.alleles) > 0
|
||||
else:
|
||||
assert isinstance(profile, MLSTProfile)
|
||||
assert profile.clonal_complex == expected_profile.clonal_complex
|
||||
assert profile.sequence_type == expected_profile.sequence_type
|
||||
|
||||
class TestBIGSdbIndex:
|
||||
|
||||
async def test_bigsdb_index_all_databases_is_not_empty(self):
|
||||
async with BIGSdbIndex() as bigsdb_index:
|
||||
assert len(await bigsdb_index.get_known_seqdef_dbs()) > 0
|
||||
|
||||
async def test_bigsdb_index_references_pubmlst_correctly(self):
|
||||
async with BIGSdbIndex() as bigsdb_index:
|
||||
assert (await bigsdb_index.get_bigsdb_api_from_seqdefdb("pubmlst_hinfluenzae_seqdef")) == "https://rest.pubmlst.org"
|
||||
|
||||
async def test_bigsdb_index_references_institutpasteur_correctly(self):
|
||||
async with BIGSdbIndex() as bigsdb_index:
|
||||
assert (await bigsdb_index.get_bigsdb_api_from_seqdefdb("pubmlst_bordetella_seqdef")) == "https://bigsdb.pasteur.fr/api"
|
||||
|
||||
async def test_bigsdb_index_get_schemas_for_bordetella(self):
|
||||
async with BIGSdbIndex() as index:
|
||||
schemas = await index.get_schemas_for_seqdefdb(seqdef_db_name="pubmlst_bordetella_seqdef")
|
||||
assert len(schemas.keys()) > 0
|
||||
assert "MLST" in schemas
|
||||
assert isinstance(schemas["MLST"], int)
|
||||
|
||||
async def test_bigsdb_index_get_databases_has_only_seqdef(self):
|
||||
async with BIGSdbIndex() as index:
|
||||
databases = await index.get_known_seqdef_dbs()
|
||||
assert len(databases.keys()) > 0
|
||||
for database_name in databases.keys():
|
||||
assert database_name.endswith("seqdef")
|
||||
assert databases["pubmlst_bordetella_seqdef"] == "https://bigsdb.pasteur.fr/api"
|
||||
|
||||
@pytest.mark.parametrize("local", [
|
||||
(False)
|
||||
])
|
||||
async def test_bigsdb_index_instantiates_correct_profiler(self, local):
|
||||
sequence = str(SeqIO.read("tests/resources/tohama_I_bpertussis.fasta", "fasta").seq)
|
||||
async with BIGSdbIndex() as bigsdb_index:
|
||||
async with await bigsdb_index.build_profiler_from_seqdefdb(local, "pubmlst_bordetella_seqdef", 3) as profiler:
|
||||
assert isinstance(profiler, BIGSdbMLSTProfiler)
|
||||
profile = await profiler.profile_string(sequence)
|
||||
assert profile.clonal_complex == "ST-2 complex"
|
||||
assert profile.sequence_type == "1"
|
||||
7
tests/autobigs/engine/test_reading.py
Normal file
7
tests/autobigs/engine/test_reading.py
Normal file
@@ -0,0 +1,7 @@
|
||||
from autobigs.engine.reading import read_fasta
|
||||
|
||||
|
||||
async def test_fasta_reader_not_none():
|
||||
named_strings = await read_fasta("tests/resources/tohama_I_bpertussis.fasta")
|
||||
for named_string in named_strings:
|
||||
assert named_string.name == "BX470248.1"
|
||||
47
tests/autobigs/engine/test_writing.py
Normal file
47
tests/autobigs/engine/test_writing.py
Normal file
@@ -0,0 +1,47 @@
|
||||
from typing import AsyncIterable, Iterable
|
||||
|
||||
import pytest
|
||||
from autobigs.engine.structures.alignment import AlignmentStats
|
||||
from autobigs.engine.writing import alleles_to_text_map, write_mlst_profiles_as_csv
|
||||
from autobigs.engine.structures.mlst import Allele, MLSTProfile, NamedMLSTProfile
|
||||
import tempfile
|
||||
from csv import reader
|
||||
from os import path
|
||||
|
||||
|
||||
@pytest.fixture
|
||||
def dummy_alphabet_mlst_profile():
|
||||
return NamedMLSTProfile("name", MLSTProfile((
|
||||
Allele("A", "1", None),
|
||||
Allele("D", "1", None),
|
||||
Allele("B", "1", None),
|
||||
Allele("C", "1", None),
|
||||
Allele("C", "2", AlignmentStats(90, 10, 0, 90))
|
||||
), "mysterious", "very mysterious"))
|
||||
|
||||
async def iterable_to_asynciterable(iterable: Iterable):
|
||||
for iterated in iterable:
|
||||
yield iterated
|
||||
|
||||
async def test_column_order_is_same_as_expected_file(dummy_alphabet_mlst_profile: MLSTProfile):
|
||||
dummy_profiles = [dummy_alphabet_mlst_profile]
|
||||
with tempfile.TemporaryDirectory() as temp_dir:
|
||||
output_path = path.join(temp_dir, "out.csv")
|
||||
await write_mlst_profiles_as_csv(iterable_to_asynciterable(dummy_profiles), output_path)
|
||||
with open(output_path) as csv_handle:
|
||||
csv_reader = reader(csv_handle)
|
||||
lines = list(csv_reader)
|
||||
target_columns = lines[4:]
|
||||
assert target_columns == sorted(target_columns)
|
||||
|
||||
async def test_alleles_to_text_map_mapping_is_correct(dummy_alphabet_mlst_profile: NamedMLSTProfile):
|
||||
mapping = alleles_to_text_map(dummy_alphabet_mlst_profile.mlst_profile.alleles) # type: ignore
|
||||
expected_mapping = {
|
||||
"A": "1",
|
||||
"B": "1",
|
||||
"C": ("1", "2*"),
|
||||
"D": "1"
|
||||
}
|
||||
for allele_name, allele_ids in mapping.items():
|
||||
assert allele_name in expected_mapping
|
||||
assert allele_ids == expected_mapping[allele_name]
|
||||
@@ -1,21 +0,0 @@
|
||||
from automlst.engine.data.local.csv import dict_loci_alleles_variants_from_loci
|
||||
from automlst.engine.data.structures.mlst import Allele
|
||||
|
||||
|
||||
def test_dict_loci_alleles_variants_from_loci_single_loci_not_list():
|
||||
alleles_map = {
|
||||
"adk": [Allele("adk", "1", None)]
|
||||
}
|
||||
results = dict_loci_alleles_variants_from_loci(alleles_map)
|
||||
for loci, variant in results.items():
|
||||
assert isinstance(variant, str)
|
||||
assert variant == "1"
|
||||
|
||||
def test_dict_loci_alleles_variants_from_loci_multi_loci_is_list():
|
||||
alleles_map = {
|
||||
"adk": [Allele("adk", "1", None), Allele("adk", "2", None)]
|
||||
}
|
||||
results = dict_loci_alleles_variants_from_loci(alleles_map)
|
||||
for loci, variant in results.items():
|
||||
assert isinstance(variant, list)
|
||||
assert len(variant) == 2
|
||||
@@ -1,7 +0,0 @@
|
||||
from automlst.engine.data.local.fasta import read_fasta
|
||||
|
||||
|
||||
async def test_fasta_reader_not_none():
|
||||
named_strings = read_fasta("tests/resources/tohama_I_bpertussis.fasta")
|
||||
async for named_string in named_strings:
|
||||
assert named_string.name == "BX470248.1"
|
||||
@@ -1,244 +0,0 @@
|
||||
import random
|
||||
import re
|
||||
from typing import Collection, Sequence, Union
|
||||
from Bio import SeqIO
|
||||
import pytest
|
||||
from automlst.engine.data.structures.genomics import NamedString
|
||||
from automlst.engine.data.structures.mlst import Allele, MLSTProfile
|
||||
from automlst.engine.exceptions.database import NoBIGSdbExactMatchesException, NoBIGSdbMatchesException
|
||||
from automlst.engine.data.remote.databases.bigsdb import BIGSdbIndex, BIGSdbMLSTProfiler
|
||||
|
||||
def gene_scrambler(gene: str, mutation_site_count: Union[int, float], alphabet: Sequence[str] = ["A", "T", "C", "G"]):
|
||||
rand = random.Random(gene)
|
||||
if isinstance(mutation_site_count, float):
|
||||
mutation_site_count = int(mutation_site_count * len(gene))
|
||||
random_locations = rand.choices(range(len(gene)), k=mutation_site_count)
|
||||
scrambled = list(gene)
|
||||
for random_location in random_locations:
|
||||
scrambled[random_location] = rand.choice(alphabet)
|
||||
return "".join(scrambled)
|
||||
|
||||
async def test_institutpasteur_profiling_results_in_exact_matches_when_exact():
|
||||
sequence = str(SeqIO.read("tests/resources/tohama_I_bpertussis.fasta", "fasta").seq)
|
||||
async with BIGSdbMLSTProfiler(database_api="https://bigsdb.pasteur.fr/api", database_name="pubmlst_bordetella_seqdef", schema_id=3) as dummy_profiler:
|
||||
targets_left = {"adk", "fumC", "glyA", "tyrB", "icd", "pepA", "pgm"}
|
||||
async for exact_match in dummy_profiler.fetch_mlst_allele_variants(sequence_string=sequence, exact=True):
|
||||
assert isinstance(exact_match, Allele)
|
||||
assert exact_match.allele_variant == '1' # All of Tohama I has allele id I
|
||||
targets_left.remove(exact_match.allele_loci)
|
||||
|
||||
assert len(targets_left) == 0
|
||||
|
||||
async def test_institutpasteur_sequence_profiling_non_exact_returns_non_exact():
|
||||
sequences = list(SeqIO.parse("tests/resources/tohama_I_bpertussis_coding.fasta", "fasta"))
|
||||
mlst_targets = {"adk", "fumc", "glya", "tyrb", "icd", "pepa", "pgm"}
|
||||
async with BIGSdbMLSTProfiler(database_api="https://bigsdb.pasteur.fr/api", database_name="pubmlst_bordetella_seqdef", schema_id=3) as profiler:
|
||||
for sequence in sequences:
|
||||
match = re.fullmatch(r".*\[gene=([\w\d]+)\].*", sequence.description)
|
||||
if match is None:
|
||||
continue
|
||||
gene = match.group(1)
|
||||
if gene.lower() not in mlst_targets:
|
||||
continue
|
||||
scrambled = gene_scrambler(str(sequence.seq), 0.125)
|
||||
async for partial_match in profiler.fetch_mlst_allele_variants(scrambled, False):
|
||||
assert partial_match.partial_match_profile is not None
|
||||
mlst_targets.remove(gene.lower())
|
||||
|
||||
assert len(mlst_targets) == 0
|
||||
|
||||
async def test_institutpasteur_profiling_results_in_correct_mlst_st():
|
||||
async def dummy_allele_generator():
|
||||
dummy_alleles = [
|
||||
Allele("adk", "1", None),
|
||||
Allele("fumC", "1", None),
|
||||
Allele("glyA", "1", None),
|
||||
Allele("tyrB", "1", None),
|
||||
Allele("icd", "1", None),
|
||||
Allele("pepA", "1", None),
|
||||
Allele("pgm", "1", None),
|
||||
]
|
||||
for dummy_allele in dummy_alleles:
|
||||
yield dummy_allele
|
||||
async with BIGSdbMLSTProfiler(database_api="https://bigsdb.pasteur.fr/api", database_name="pubmlst_bordetella_seqdef", schema_id=3) as dummy_profiler:
|
||||
mlst_st_data = await dummy_profiler.fetch_mlst_st(dummy_allele_generator())
|
||||
assert mlst_st_data is not None
|
||||
assert isinstance(mlst_st_data, MLSTProfile)
|
||||
assert mlst_st_data.clonal_complex == "ST-2 complex"
|
||||
assert mlst_st_data.sequence_type == "1"
|
||||
|
||||
async def test_institutpasteur_profiling_non_exact_results_in_list_of_mlsts():
|
||||
dummy_alleles = [
|
||||
Allele("adk", "1", None),
|
||||
Allele("fumC", "2", None),
|
||||
Allele("glyA", "36", None),
|
||||
Allele("tyrB", "4", None),
|
||||
Allele("icd", "4", None),
|
||||
Allele("pepA", "1", None),
|
||||
Allele("pgm", "5", None),
|
||||
]
|
||||
async with BIGSdbMLSTProfiler(database_api="https://bigsdb.pasteur.fr/api", database_name="pubmlst_bordetella_seqdef", schema_id=3) as dummy_profiler:
|
||||
mlst_profile = await dummy_profiler.fetch_mlst_st(dummy_alleles)
|
||||
assert mlst_profile.clonal_complex == "unknown"
|
||||
assert mlst_profile.sequence_type == "unknown"
|
||||
|
||||
|
||||
async def test_institutpasteur_sequence_profiling_is_correct():
|
||||
sequence = str(SeqIO.read("tests/resources/tohama_I_bpertussis.fasta", "fasta").seq)
|
||||
async with BIGSdbMLSTProfiler(database_api="https://bigsdb.pasteur.fr/api", database_name="pubmlst_bordetella_seqdef", schema_id=3) as dummy_profiler:
|
||||
profile = await dummy_profiler.profile_string(sequence)
|
||||
assert profile is not None
|
||||
assert isinstance(profile, MLSTProfile)
|
||||
assert profile.clonal_complex == "ST-2 complex"
|
||||
assert profile.sequence_type == "1"
|
||||
|
||||
|
||||
async def test_pubmlst_profiling_results_in_exact_matches_when_exact():
|
||||
dummy_alleles = {
|
||||
Allele("adk", "1", None),
|
||||
Allele("atpG", "1", None),
|
||||
Allele("frdB", "1", None),
|
||||
Allele("fucK", "1", None),
|
||||
Allele("mdh", "1", None),
|
||||
Allele("pgi", "1", None),
|
||||
Allele("recA", "5", None),
|
||||
}
|
||||
sequence = str(SeqIO.read("tests/resources/FDAARGOS_1560.fasta", "fasta").seq)
|
||||
async with BIGSdbMLSTProfiler(database_api="https://rest.pubmlst.org/", database_name="pubmlst_hinfluenzae_seqdef", schema_id=1) as dummy_profiler:
|
||||
exact_matches = dummy_profiler.fetch_mlst_allele_variants(sequence_string=sequence, exact=True)
|
||||
async for exact_match in exact_matches:
|
||||
assert isinstance(exact_match, Allele)
|
||||
dummy_alleles.remove(exact_match)
|
||||
|
||||
assert len(dummy_alleles) == 0
|
||||
|
||||
async def test_pubmlst_profiling_results_in_correct_st():
|
||||
async def generate_dummy_targets():
|
||||
dummy_alleles = [
|
||||
Allele("adk", "1", None),
|
||||
Allele("atpG", "1", None),
|
||||
Allele("frdB", "1", None),
|
||||
Allele("fucK", "1", None),
|
||||
Allele("mdh", "1", None),
|
||||
Allele("pgi", "1", None),
|
||||
Allele("recA", "5", None),
|
||||
]
|
||||
for dummy_allele in dummy_alleles:
|
||||
yield dummy_allele
|
||||
async with BIGSdbMLSTProfiler(database_api="https://rest.pubmlst.org/", database_name="pubmlst_hinfluenzae_seqdef", schema_id=1) as dummy_profiler:
|
||||
mlst_st_data = await dummy_profiler.fetch_mlst_st(generate_dummy_targets())
|
||||
assert mlst_st_data is not None
|
||||
assert isinstance(mlst_st_data, MLSTProfile)
|
||||
assert mlst_st_data.clonal_complex == "ST-3 complex"
|
||||
assert mlst_st_data.sequence_type == "3"
|
||||
|
||||
async def test_pubmlst_sequence_profiling_is_correct():
|
||||
sequence = str(SeqIO.read("tests/resources/FDAARGOS_1560.fasta", "fasta").seq)
|
||||
async with BIGSdbMLSTProfiler(database_api="https://rest.pubmlst.org/", database_name="pubmlst_hinfluenzae_seqdef", schema_id=1) as dummy_profiler:
|
||||
profile = await dummy_profiler.profile_string(sequence)
|
||||
assert profile is not None
|
||||
assert isinstance(profile, MLSTProfile)
|
||||
assert profile.clonal_complex == "ST-3 complex"
|
||||
assert profile.sequence_type == "3"
|
||||
|
||||
async def test_bigsdb_index_all_databases_is_not_empty():
|
||||
async with BIGSdbIndex() as bigsdb_index:
|
||||
assert len(await bigsdb_index.get_known_seqdef_dbs()) > 0
|
||||
|
||||
async def test_bigsdb_index_references_pubmlst_correctly():
|
||||
async with BIGSdbIndex() as bigsdb_index:
|
||||
assert (await bigsdb_index.get_bigsdb_api_from_seqdefdb("pubmlst_hinfluenzae_seqdef")) == "https://rest.pubmlst.org"
|
||||
|
||||
async def test_bigsdb_index_references_institutpasteur_correctly():
|
||||
async with BIGSdbIndex() as bigsdb_index:
|
||||
assert (await bigsdb_index.get_bigsdb_api_from_seqdefdb("pubmlst_bordetella_seqdef")) == "https://bigsdb.pasteur.fr/api"
|
||||
|
||||
|
||||
async def test_bigsdb_index_instantiates_correct_profiler():
|
||||
sequence = str(SeqIO.read("tests/resources/tohama_I_bpertussis.fasta", "fasta").seq)
|
||||
async with BIGSdbIndex() as bigsdb_index:
|
||||
async with await bigsdb_index.build_profiler_from_seqdefdb("pubmlst_bordetella_seqdef", 3) as profiler:
|
||||
profile = await profiler.profile_string(sequence)
|
||||
assert profile.clonal_complex == "ST-2 complex"
|
||||
assert profile.sequence_type == "1"
|
||||
|
||||
async def test_bigsdb_profile_multiple_strings_same_string_twice():
|
||||
sequence = str(SeqIO.read("tests/resources/tohama_I_bpertussis.fasta", "fasta").seq)
|
||||
dummy_sequences = [NamedString("seq1", sequence), NamedString("seq2", sequence)]
|
||||
async def generate_async_iterable_sequences():
|
||||
for dummy_sequence in dummy_sequences:
|
||||
yield dummy_sequence
|
||||
async with BIGSdbMLSTProfiler(database_api="https://bigsdb.pasteur.fr/api", database_name="pubmlst_bordetella_seqdef", schema_id=3) as dummy_profiler:
|
||||
async for name, profile in dummy_profiler.profile_multiple_strings(generate_async_iterable_sequences()):
|
||||
assert profile is not None
|
||||
assert isinstance(profile, MLSTProfile)
|
||||
assert profile.clonal_complex == "ST-2 complex"
|
||||
assert profile.sequence_type == "1"
|
||||
|
||||
async def test_bigsdb_profile_multiple_strings_exactmatch_fail_second_no_stop():
|
||||
valid_seq = str(SeqIO.read("tests/resources/tohama_I_bpertussis.fasta", "fasta").seq)
|
||||
dummy_sequences = [NamedString("seq1", valid_seq), NamedString("should_fail", gene_scrambler(valid_seq, 0.3)), NamedString("seq3", valid_seq)]
|
||||
async def generate_async_iterable_sequences():
|
||||
for dummy_sequence in dummy_sequences:
|
||||
yield dummy_sequence
|
||||
async with BIGSdbMLSTProfiler(database_api="https://bigsdb.pasteur.fr/api", database_name="pubmlst_bordetella_seqdef", schema_id=3) as dummy_profiler:
|
||||
async for name, profile in dummy_profiler.profile_multiple_strings(generate_async_iterable_sequences(), True):
|
||||
if name == "should_fail":
|
||||
assert profile is None
|
||||
else:
|
||||
assert profile is not None
|
||||
assert isinstance(profile, MLSTProfile)
|
||||
assert profile.clonal_complex == "ST-2 complex"
|
||||
assert profile.sequence_type == "1"
|
||||
|
||||
async def test_bigsdb_profile_multiple_strings_nonexact_second_no_stop():
|
||||
valid_seq = str(SeqIO.read("tests/resources/tohama_I_bpertussis.fasta", "fasta").seq)
|
||||
dummy_sequences = [NamedString("seq1", valid_seq), NamedString("should_fail", gene_scrambler(valid_seq, 0.3)), NamedString("seq3", valid_seq)]
|
||||
async def generate_async_iterable_sequences():
|
||||
for dummy_sequence in dummy_sequences:
|
||||
yield dummy_sequence
|
||||
async with BIGSdbMLSTProfiler(database_api="https://bigsdb.pasteur.fr/api", database_name="pubmlst_bordetella_seqdef", schema_id=3) as dummy_profiler:
|
||||
async for name, profile in dummy_profiler.profile_multiple_strings(generate_async_iterable_sequences(), False):
|
||||
if name == "should_fail":
|
||||
assert profile is not None
|
||||
assert profile.clonal_complex == "unknown"
|
||||
assert profile.sequence_type == "unknown"
|
||||
assert len(profile.alleles) > 0
|
||||
else:
|
||||
assert profile is not None
|
||||
assert isinstance(profile, MLSTProfile)
|
||||
assert profile.clonal_complex == "ST-2 complex"
|
||||
assert profile.sequence_type == "1"
|
||||
|
||||
async def test_bigsdb_profile_multiple_strings_fail_second_stop():
|
||||
valid_seq = str(SeqIO.read("tests/resources/tohama_I_bpertussis.fasta", "fasta").seq)
|
||||
invalid_seq = str(SeqIO.read("tests/resources/FDAARGOS_1560.fasta", "fasta").seq)
|
||||
dummy_sequences = [NamedString("seq1", valid_seq), NamedString("should_fail", invalid_seq), NamedString("seq3", valid_seq)]
|
||||
async def generate_async_iterable_sequences():
|
||||
for dummy_sequence in dummy_sequences:
|
||||
yield dummy_sequence
|
||||
async with BIGSdbMLSTProfiler(database_api="https://bigsdb.pasteur.fr/api", database_name="pubmlst_bordetella_seqdef", schema_id=3) as dummy_profiler:
|
||||
with pytest.raises(NoBIGSdbMatchesException):
|
||||
async for name, profile in dummy_profiler.profile_multiple_strings(generate_async_iterable_sequences(), exact=True, stop_on_fail=True):
|
||||
if name == "should_fail":
|
||||
pytest.fail("Exception should have been thrown, no exception was thrown.")
|
||||
else:
|
||||
assert profile is not None
|
||||
assert isinstance(profile, MLSTProfile)
|
||||
assert profile.clonal_complex == "ST-2 complex"
|
||||
assert profile.sequence_type == "1"
|
||||
|
||||
async def test_bigsdb_index_get_schemas_for_bordetella():
|
||||
async with BIGSdbIndex() as index:
|
||||
schemas = await index.get_schemas_for_seqdefdb(seqdef_db_name="pubmlst_bordetella_seqdef")
|
||||
assert len(schemas.keys()) > 0
|
||||
assert "MLST" in schemas
|
||||
assert isinstance(schemas["MLST"], int)
|
||||
|
||||
async def test_bigsdb_index_get_databases_has_only_seqdef():
|
||||
async with BIGSdbIndex() as index:
|
||||
databases = await index.get_known_seqdef_dbs()
|
||||
assert len(databases.keys()) > 0
|
||||
for database_name in databases.keys():
|
||||
assert database_name.endswith("seqdef")
|
||||
assert databases["pubmlst_bordetella_seqdef"] == "https://bigsdb.pasteur.fr/api"
|
||||
28244
tests/resources/2014-102_hinfluenza.fasta
Normal file
28244
tests/resources/2014-102_hinfluenza.fasta
Normal file
File diff suppressed because it is too large
Load Diff
27751
tests/resources/2014-102_hinfluenza_features.fasta
Normal file
27751
tests/resources/2014-102_hinfluenza_features.fasta
Normal file
File diff suppressed because it is too large
Load Diff
File diff suppressed because it is too large
Load Diff
11
tests/resources/tohama_I_bpertussis_adk.fasta
Normal file
11
tests/resources/tohama_I_bpertussis_adk.fasta
Normal file
@@ -0,0 +1,11 @@
|
||||
>lcl|BX640419.1_cds_CAE43044.1_2724 [gene=adK] [locus_tag=BP2769] [db_xref=GOA:P0DKX8,InterPro:IPR000850,InterPro:IPR006259,InterPro:IPR007862,InterPro:IPR027417] [protein=adenylate kinase] [protein_id=CAE43044.1] [location=164032..164688] [gbkey=CDS]
|
||||
ATGCGTCTCATTCTGCTCGGACCGCCCGGAGCCGGCAAAGGCACCCAAGCCGCCTTTCTCACCCAACACT
|
||||
ACGGCATCCCGCAGATATCCACCGGTGACATGCTGCGCGCCGCCGTCAAGGCCGGCACGCCGCTGGGCCT
|
||||
GGAAGCCAAGAAGGTCATGGACGCGGGCGGCCTGGTCTCGGACGACCTGATCATCGGCCTGGTGCGCGAT
|
||||
CGCCTGACCCAGCCCGATTGCGCCAACGGCTACCTGTTCGACGGTTTCCCGCGCACCATCCCGCAGGCCG
|
||||
ACGCGCTCAAGAGCGCCGGCATCGCGCTGGATTACGTGGTCGAGATCGAAGTGCCGGAAAGCGACATCAT
|
||||
CGAACGCATGAGCGAACGCCGCGTGCACCCGGCCAGCGGCCGCAGCTACCACGTACGCTTCAATCCGCCC
|
||||
AAGGCCGAAGGCGTGGACGACGTCACGGGCGAACCGCTGGTGCAGCGCGACGACGACCGCGAGGAAACCG
|
||||
TGCGCCATCGTCTCAACGTCTACCAGAACCAGACCCGCCCGCTGGTCGACTACTACTCGTCCTGGGCCCA
|
||||
GTCCGATGCCGCCGCGGCGCCCAAGTACCGCAAGATCTCCGGCGTCGGCTCGGTCGACGAAATCAAGAGC
|
||||
CGCCTGTCGCAGGCTCTGCAGAGCTAA
|
||||
Reference in New Issue
Block a user