Updated publication credentials

.devcontainer/devcontainer.json

@@ -0,0 +1,22 @@
+// For format details, see https://aka.ms/devcontainer.json. For config options, see the
+// README at: https://github.com/devcontainers/templates/tree/main/src/python
+{
+	"name": "Python 3",
+	// Or use a Dockerfile or Docker Compose file. More info: https://containers.dev/guide/dockerfile
+	"image": "mcr.microsoft.com/devcontainers/python:1-3.12-bullseye"
+
+	// Features to add to the dev container. More info: https://containers.dev/features.
+	// "features": {},
+
+	// Use 'forwardPorts' to make a list of ports inside the container available locally.
+	// "forwardPorts": [],
+
+	// Use 'postCreateCommand' to run commands after the container is created.
+	// "postCreateCommand": "pip3 install --user -r requirements.txt",
+
+	// Configure tool-specific properties.
+	// "customizations": {},
+
+	// Uncomment to connect as root instead. More info: https://aka.ms/dev-containers-non-root.
+	// "remoteUser": "root"
+}

.gitignore

@@ -213,3 +213,5 @@ pyrightconfig.json
 # Custom rules (everything added below won't be overriden by 'Generate .gitignore File' if you use 'Update' option)
 
 output
+!docs/source/
+docs/source/autodoc

.vscode/settings.json

@@ -7,5 +7,6 @@
         "FASTA"
     ],
     "python.testing.pytestEnabled": true,
-    "python.analysis.inlayHints.pytestParameters": true
+    "python.analysis.inlayHints.pytestParameters": true,
+    "autoDocstring.docstringFormat": "sphinx"
 }

Jenkinsfile

@@ -1,33 +1,41 @@
 pipeline {
-    agent any
-    stages {
-        stage("clean") {
-            steps {
-                sh 'rm -rf ./dist/*'
-            }
+    agent {
+        kubernetes {
+            cloud 'rsys-devel'
+            defaultContainer 'pip'
+            inheritFrom 'pip'
         }
+    }
+
+    stages {
         stage("install") {
             steps {
-                sh 'mamba env update --file environment.yml || mamba env create --force --file environment.yml'
-                sh 'echo "mamba activate bmlsa" >> ~/.bashrc'
+                sh 'pip install -r requirements.txt'
             }
         }
         stage("unit tests") {
             steps {
-                sh "python -m pytest --junitxml=test_results.xml"
+                sh returnStatus: true, script: "python -m pytest --junitxml=test_results.xml"
                 xunit checksName: '', tools: [JUnit(excludesPattern: '', pattern: 'test_results.xml', stopProcessingIfError: true)]
             }
         }
         stage("build") {
             steps {
+                sh 'rm -rf ./dist/*'
+                sh 'rm -rf ./docs/build/*'
                 sh "python -m build"
+                container('sphinx') {
+                    sh 'sphinx-apidoc -o docs/source/autodoc/bmlsa src/bmlsa --force'
+                    sh 'sphinx-build -M html ./docs/source ./docs/build'
+                    publishHTML([allowMissing: false, alwaysLinkToLastBuild: false, keepAll: false, reportDir: 'docs/build/html', reportFiles: 'index.html', reportName: 'Documentation', reportTitles: ''])
+                }
             }
         }
         stage("test installation") {
             steps {
                 sh "pip install dist/*.whl --force-reinstall"
                 sh "bmlsa -h"
-                sh "bmlsa -I id -S sequence -B BLASTp tests/resources/SARS_CoV-2_genes.csv tests/resources/NC_045512_coding.fasta /output/"
+                sh "bmlsa -I id -S sequence -B BLASTp tests/resources/SARS_CoV-2_genes.csv tests/resources/NC_045512_coding.fasta ./output/"
             }
         }
         stage("archive") {
@@ -40,7 +48,7 @@ pipeline {
                 branch '**/master'
             }
             steps {
-                withCredentials([usernamePassword(credentialsId: 'rs-git-package-registry-ydeng', passwordVariable: 'PASS', usernameVariable: 'USER')]) {
+                withCredentials([usernamePassword(credentialsId: '4d6f64be-d26d-4f95-8de3-b6a9b0beb311', passwordVariable: 'PASS', usernameVariable: 'USER')]) {
                     sh returnStatus: true, script: 'python -m twine upload --repository-url https://git.reslate.systems/api/packages/${USER}/pypi -u ${USER} -p ${PASS} --non-interactive --disable-progress-bar --verbose dist/*'
                 }
             }

README.md

@@ -1,6 +1,8 @@
+[![Build Status](https://ci.reslate.systems/job/ydeng/job/bmlsa/job/master/badge/icon)](https://ci.reslate.systems/job/ydeng/job/bmlsa/job/master/)
+
 # BMLSA
 
-A Basic multi local sequence alignment tool using the Biopython implementation of the Smith-Waterman alignment algorithm.
+A Basic multi local sequence alignment tool using the Biopython implementation of the Smith-Waterman alignment algorithm. May be used as a python library, or as a full command line interface.
 
 ## Features
 
@@ -11,3 +13,21 @@ A Basic multi local sequence alignment tool using the Biopython implementation o
  - Automatically align with all sequences in reference FASTA
  - All produced output is human readable!
 
+ ## Install via `pip`
+
+Just run `pip install --index-url https://git.reslate.systems/api/packages/ydeng/pypi/simple/ bmlsa` in a console that is capable of running `pip`!
+
+## CLI Demo from Git Repo
+
+Resources have been provided in this package for CI purposes, but you may use them to try out the program yourself!
+
+1. Install the program
+2. clone this repository
+3. Change into the cloned repository directory
+4. Run `bmlsa -I id -S sequence -B BLASTp tests/resources/SARS_CoV-2_genes.csv tests/resources/NC_045512_coding.fasta ./output/`
+
+The results will show up in a `output` folder (which will be generated if it doesn't exist). Use `bmlsa -h` to see what each part of the above command does!
+
+## More Information
+
+For all live downloadable artifacts, build statuses, unit test results, and documentation, check out the continuous integration page for the [master branch](https://ci.reslate.systems/job/ydeng/job/bmlsa/job/master/) ([development branch](https://ci.reslate.systems/job/ydeng/job/bmlsa/job/develop/)).

docs/Makefile

@@ -0,0 +1,20 @@
+# Minimal makefile for Sphinx documentation
+#
+
+# You can set these variables from the command line, and also
+# from the environment for the first two.
+SPHINXOPTS    ?=
+SPHINXBUILD   ?= sphinx-build
+SOURCEDIR     = source
+BUILDDIR      = build
+
+# Put it first so that "make" without argument is like "make help".
+help:
+	@$(SPHINXBUILD) -M help "$(SOURCEDIR)" "$(BUILDDIR)" $(SPHINXOPTS) $(O)
+
+.PHONY: help Makefile
+
+# Catch-all target: route all unknown targets to Sphinx using the new
+# "make mode" option.  $(O) is meant as a shortcut for $(SPHINXOPTS).
+%: Makefile
+	@$(SPHINXBUILD) -M $@ "$(SOURCEDIR)" "$(BUILDDIR)" $(SPHINXOPTS) $(O)

docs/make.bat

@@ -0,0 +1,35 @@
+@ECHO OFF
+
+pushd %~dp0
+
+REM Command file for Sphinx documentation
+
+if "%SPHINXBUILD%" == "" (
+	set SPHINXBUILD=sphinx-build
+)
+set SOURCEDIR=source
+set BUILDDIR=build
+
+%SPHINXBUILD% >NUL 2>NUL
+if errorlevel 9009 (
+	echo.
+	echo.The 'sphinx-build' command was not found. Make sure you have Sphinx
+	echo.installed, then set the SPHINXBUILD environment variable to point
+	echo.to the full path of the 'sphinx-build' executable. Alternatively you
+	echo.may add the Sphinx directory to PATH.
+	echo.
+	echo.If you don't have Sphinx installed, grab it from
+	echo.https://www.sphinx-doc.org/
+	exit /b 1
+)
+
+if "%1" == "" goto help
+
+%SPHINXBUILD% -M %1 %SOURCEDIR% %BUILDDIR% %SPHINXOPTS% %O%
+goto end
+
+:help
+%SPHINXBUILD% -M help %SOURCEDIR% %BUILDDIR% %SPHINXOPTS% %O%
+
+:end
+popd

docs/source/conf.py

@@ -0,0 +1,33 @@
+import os
+import sys
+
+# Configure system path
+
+sys.path.insert(0, os.path.abspath("../../src/"))
+
+# Configuration file for the Sphinx documentation builder.
+#
+# For the full list of built-in configuration values, see the documentation:
+# https://www.sphinx-doc.org/en/master/usage/configuration.html
+
+# -- Project information -----------------------------------------------------
+# https://www.sphinx-doc.org/en/master/usage/configuration.html#project-information
+
+project = "BMLSA"
+copyright = "2023, Harrison"
+author = "Harrison"
+
+# -- General configuration ---------------------------------------------------
+# https://www.sphinx-doc.org/en/master/usage/configuration.html#general-configuration
+
+extensions = ["sphinx.ext.autodoc"]
+
+templates_path = ["_templates"]
+exclude_patterns = []
+
+
+# -- Options for HTML output -------------------------------------------------
+# https://www.sphinx-doc.org/en/master/usage/configuration.html#options-for-html-output
+
+html_theme = "alabaster"
+html_static_path = ["_static"]

docs/source/index.rst

@@ -0,0 +1,22 @@
+.. BMLSA documentation master file, created by
+   sphinx-quickstart on Fri Apr 28 13:04:16 2023.
+   You can adapt this file completely to your liking, but it should at least
+   contain the root `toctree` directive.
+
+Welcome to BMLSA's documentation!
+=================================
+
+.. toctree::
+   :glob:
+   :maxdepth: 2
+   :caption: Contents:
+   
+   autodoc/**/modules
+
+
+Indices and tables
+==================
+
+* :ref:`genindex`
+* :ref:`modindex`
+* :ref:`search`

environment.yml

@@ -7,4 +7,6 @@ dependencies:
   - hypothesis=6.56
   - twine=4
   - python-build=0.10.0
-  - setuptools
+  - setuptools=67.6
+  - sphinx=6.2
+prefix: ./env

requirements.txt

@@ -0,0 +1,6 @@
+biopython==1.81
+pytest
+hypothesis
+twine
+build
+setuptools

src/bmlsa/aligner.py

@@ -1,20 +1,36 @@
 import logging
-from typing import Iterable
+from typing import Generator, Iterable
 from Bio.Align import PairwiseAligner, substitution_matrices
-from bmlsa.datatypes import AlignedSequence
-from bmlsa.exceptions import UnexpectedAlignmentResult
+from bmlsa.datatypes import QuerySequence
 
 logger = logging.getLogger(__name__)
 
 
 def align_many_to_one_ssw(
     reference_sequence: str,
-    queries: Iterable[AlignedSequence],
+    queries: Iterable[QuerySequence],
     extend_gap_score: int,
     open_gap_score: int,
     alignment_mode: str,
     substitution_matrix: str = "BLOSUM62",
-):
+) -> Generator[tuple[QuerySequence, QuerySequence], None, None]:
+    """Aligns :obj:`bmlsa.datatypes.QuerySequence` objects to a given reference sequence
+
+    :param reference_sequence: The reference sequence to align to
+    :type reference_sequence: str
+    :param queries: A iterable sequence of :obj:`bmlsa.datatypes.QuerySequence`
+    :type queries: Iterable[QuerySequence]
+    :param extend_gap_score: The gap score to use for alignment. Typically negative.
+    :type extend_gap_score: int
+    :param open_gap_score: The open gap score to use for alignment. Typically negative.
+    :type open_gap_score: int
+    :param alignment_mode: The alignment mode to use. Either "local" or "global".
+    :type alignment_mode: str
+    :param substitution_matrix: The name of the substitution matrix available in :mod:`Bio.Align`, defaults to "BLOSUM62"
+    :type substitution_matrix: str, optional
+    :yield: Pairs of :obj:`bmlsa.datatypes.QuerySequence` objects where the first is the original, and the second is the aligned version
+    :rtype: a generator of :obj:`bmlsa.datatypes.QuerySequence` objects
+    """
     # TODO Consider using the built in "scoring" parameter
     aligner = PairwiseAligner()
     aligner.substitution_matrix = substitution_matrices.load(substitution_matrix)
@@ -30,14 +46,10 @@ def align_many_to_one_ssw(
             )
             continue
         # TODO Implement comparison with input positions to choose best
-        if len(alignments) > 1:
-            raise UnexpectedAlignmentResult(
-                "More than one alignment resulted from a single query."
-            )
         for alignment in alignments:
             score, query_aligned = (alignment.score, alignment.aligned[0][0])
             aligned_start, aligned_end = query_aligned
-            yield AlignedSequence(
+            yield QuerySequence(
                 query.id,
                 query.sequence,
                 query.name,
@@ -45,7 +57,7 @@ def align_many_to_one_ssw(
                 query.start,
                 query.end,
                 query.score,
-            ), AlignedSequence(
+            ), QuerySequence(
                 query.id,
                 alignment.query,
                 query.name,

src/bmlsa/cli.py

@@ -4,7 +4,7 @@ from Bio import SeqIO
 import logging
 from bmlsa.aligner import align_many_to_one_ssw
 
-from bmlsa.io import read_annotations_from_csv, save_alignments_to_csv
+from bmlsa.io import queries_from_csv, save_alignments_to_csv
 
 logger = logging.getLogger(__name__)
 
@@ -29,8 +29,8 @@ def run(args):
             "more information."
         )
         exit(3)
-    queries = read_annotations_from_csv(
-        args.annotations,
+    queries = queries_from_csv(
+        args.queries,
         args.id_header,
         args.seq_header,
         args.name_header,
@@ -59,11 +59,11 @@ def run(args):
     os.makedirs(args.output, exist_ok=True)
     with open(args.sequence, "r") as sequence_fd:
         for sequence in SeqIO.parse(sequence_fd, "fasta"):
-            aligned_annotations = align_many_to_one_ssw(
+            aligned_queries = align_many_to_one_ssw(
                 str(sequence.seq), queries, **scoring_parameter
             )
             save_alignments_to_csv(
-                aligned_annotations,
+                aligned_queries,
                 os.path.join(
                     args.output,
                     sequence.id.replace("|", "+").replace(".", "_") + ".csv",
@@ -74,11 +74,11 @@ def run(args):
 def main():
     arg_parser = argparse.ArgumentParser("bmlsa")
     arg_parser.add_argument(
-        "annotations",
+        "queries",
         type=str,
         help=(
             "Path to CSV containing the sequences to align as well as the "
-            "annotations for the respective sequences."
+            "queries for the respective sequences."
         ),
         metavar="a",
     )

src/bmlsa/datatypes.py

@@ -1,4 +1,6 @@
-class AlignedSequence:
+class QuerySequence:
+    """Represents a sequence that may be aligned."""
+
     def __init__(
         self,
         id: str,
@@ -9,6 +11,23 @@ class AlignedSequence:
         end: int = None,
         score: int = None,
     ) -> None:
+        """Instantiates a :obj:bmlsa.datatypes.QuerySequence object
+
+        :param id: The id of the query sequence
+        :type id: str
+        :param sequence: The sequence itself
+        :type sequence: str
+        :param name: The name of the sequence, defaults to None
+        :type name: str, optional
+        :param description: The description of the sequence, defaults to None
+        :type description: str, optional
+        :param start: The start of the sequence, defaults to None
+        :type start: int, optional
+        :param end: The end of the sequence, defaults to None
+        :type end: int, optional
+        :param score: The alignment score of the sequence, defaults to None
+        :type score: int, optional
+        """
         self._description = description
         self._start = start
         self._end = end

src/bmlsa/io.py

@@ -1,10 +1,10 @@
 import csv
-from typing import Iterable
+from typing import Generator, Iterable
 
-from bmlsa.datatypes import AlignedSequence
+from bmlsa.datatypes import QuerySequence
 
 
-def read_annotations_from_csv(
+def queries_from_csv(
     csv_path: str,
     id_header: str,
     sequence_header: str,
@@ -12,7 +12,26 @@ def read_annotations_from_csv(
     desc_header: str = None,
     start_header: str = None,
     end_header: str = None,
-):
+) -> Generator[QuerySequence, None, None]:
+    """Generates and :obj:`bmlsa.datatypes.QuerySequence` instances from a CSV file.
+
+    :param csv_path: Path to CSV to use
+    :type csv_path: str
+    :param id_header: The column title for the unique identifier for each query sequence
+    :type id_header: str
+    :param sequence_header: The column title for the sequences themselves
+    :type sequence_header: str
+    :param name_header: The column title for the name of the sequence, defaults to None
+    :type name_header: str, optional
+    :param desc_header: The column title for the description of the sequence, defaults to None
+    :type desc_header: str, optional
+    :param start_header: The column title for the start position of the sequence, defaults to None
+    :type start_header: str, optional
+    :param end_header: The column title for the end position of the sequence, defaults to None
+    :type end_header: str, optional
+    :yield: One :obj:`bmlsa.datatypes.QuerySequence` for each row
+    :rtype: A generator that yields objects of :class:`bmlsa.datatypes.QuerySequence`
+    """
     with open(csv_path, "r") as csv_fd:
         reader = csv.reader(csv_fd)
         id_ind = None
@@ -38,7 +57,7 @@ def read_annotations_from_csv(
             desc = row[desc_ind] if desc_header else None
             start = row[start_ind] if start_header else None
             end = row[end_ind] if end_header else None
-            yield AlignedSequence(
+            yield QuerySequence(
                 id,
                 sequence,
                 name,
@@ -49,8 +68,15 @@ def read_annotations_from_csv(
 
 
 def save_alignments_to_csv(
-    aligned_pairs: Iterable[tuple[AlignedSequence, AlignedSequence]], output_path: str
-):
+    aligned_pairs: Iterable[tuple[QuerySequence, QuerySequence]], output_path: str
+) -> None:
+    """Saves alignments to a CSV.
+
+    :param aligned_pairs: An iterable of the original sequence and aligned sequences
+    :type aligned_pairs: Iterable[tuple[AlignedSequence, AlignedSequence]]
+    :param output_path: A path to the output directory
+    :type output_path: str
+    """
     with open(output_path, "w") as output_fd:
         writer = csv.writer(output_fd)
         header_wrote = False

tests/bmlsa/test_aligner.py

@@ -2,7 +2,7 @@ import pytest
 from Bio import SeqIO
 from bmlsa.aligner import align_many_to_one_ssw
 from bmlsa.cli import DEFAULT_ALIGNMENT_PARAMETERS
-from bmlsa.datatypes import AlignedSequence
+from bmlsa.datatypes import QuerySequence
 from collections.abc import Iterable
 
 
@@ -16,7 +16,7 @@ def reference_sequence():
 @pytest.fixture
 def queries():
     return [
-        AlignedSequence(
+        QuerySequence(
             "ORF10",
             "ATGGGCTATATAAACGTTTTCGCTTTTCCGTTTACGATATATAGTCTACTCTTGTGCAGAAT"
             "GAATTCTCGTAACTACATAGCACAAGTAGATGTAGTTAACTTTAATCTCACATAG",
@@ -38,8 +38,8 @@ def test_align_many_to_one_returns_correct_data_structure(reference_sequence, qu
         reference_sequence, queries, **DEFAULT_ALIGNMENT_PARAMETERS["BLASTp"]
     )
     for original, aligned_seq in results:
-        assert isinstance(original, AlignedSequence)
-        assert isinstance(aligned_seq, AlignedSequence)
+        assert isinstance(original, QuerySequence)
+        assert isinstance(aligned_seq, QuerySequence)
 
 
 def test_align_many_to_one_returns_correct_data(reference_sequence, queries):

tests/bmlsa/test_io.py

@@ -1,21 +1,17 @@
 from csv import reader
 from os import path
-from bmlsa.datatypes import AlignedSequence
-from bmlsa.io import read_annotations_from_csv, save_alignments_to_csv
+from bmlsa.datatypes import QuerySequence
+from bmlsa.io import queries_from_csv, save_alignments_to_csv
 from collections.abc import Iterable
 
 
-def test_read_annotations_from_csv_has_data():
-    results = read_annotations_from_csv(
-        "tests/resources/SARS_CoV-2_genes.csv", "id", "sequence"
-    )
+def test_queries_from_csv_has_data():
+    results = queries_from_csv("tests/resources/SARS_CoV-2_genes.csv", "id", "sequence")
     assert isinstance(results, Iterable)
 
 
-def test_read_annotations_from_csv_data_valid():
-    results = read_annotations_from_csv(
-        "tests/resources/SARS_CoV-2_genes.csv", "id", "sequence"
-    )
+def test_queries_from_csv_data_valid():
+    results = queries_from_csv("tests/resources/SARS_CoV-2_genes.csv", "id", "sequence")
     for aligned_seq in results:
         assert isinstance(aligned_seq.id, str)
         assert isinstance(aligned_seq.sequence, str)
@@ -23,7 +19,7 @@ def test_read_annotations_from_csv_data_valid():
 
 def test_save_alignments_to_csv_produces_correct_headers_in_csv(tmpdir):
     output_path = path.join(tmpdir, "alignment_results.csv")
-    dummy_sequence = AlignedSequence("DUMMY", "ATACTGGAAAA", name="test_sequence")
+    dummy_sequence = QuerySequence("DUMMY", "ATACTGGAAAA", name="test_sequence")
     alignments = [(dummy_sequence, dummy_sequence)]
     save_alignments_to_csv(alignments, output_path)