Deleted galaxy-server folder

shedfile now passes planemo linting

.devcontainer/Dockerfile

@@ -0,0 +1,16 @@
+FROM mcr.microsoft.com/devcontainers/miniconda:1-3
+
+# Copy environment.yml (if found) to a temp location so we update the environment. Also
+# copy "noop.txt" so the COPY instruction does not fail if no environment.yml exists.
+COPY environment.yml* .devcontainer/noop.txt /tmp/conda-tmp/
+RUN if [ -f "/tmp/conda-tmp/environment.yml" ]; then umask 0002 && /opt/conda/bin/conda env update -n base -f /tmp/conda-tmp/environment.yml; fi \
+    && rm -rf /tmp/conda-tmp
+
+# [Optional] Uncomment to install a different version of Python than the default
+# RUN conda install -y python=3.6 \
+#     && pip install --no-cache-dir pipx \
+#     && pipx reinstall-all
+
+# [Optional] Uncomment this section to install additional OS packages.
+# RUN apt-get update && export DEBIAN_FRONTEND=noninteractive \
+#     && apt-get -y install --no-install-recommends <your-package-list-here>

.devcontainer/noop.txt

@@ -0,0 +1,3 @@
+This file is copied into the container along with environment.yml* from the
+parent folder. This is done to prevent the Dockerfile COPY instruction from 
+failing if no environment.yml is found.

.gitignore

@@ -1,2 +1,3 @@
+galaxy-server/**
+test_results
 autobigs-cli_test_report.html
-galaxy-server/**

.shed.yml

@@ -0,0 +1,12 @@
+name: autobigs
+owner: iuc
+description: Automated MLST typing from PubMLST and InstitutPasteur.
+homepage_url: https://github.com/Syph-and-VPD-Lab/autoBIGS.cli
+long_description: |
+  A program that allows quickly batched requests for obtaining MLST 
+  profiles on multiple FASTA sequences and exporting it as a convenient 
+  CSV. Capable of querying a variety of MLST databases from both 
+  Institut Pasteur and PubMLST.
+remote_repository_url: https://github.com/Syph-and-VPD-Lab/autoBIGS.cli
+categories:
+- Sequence Analysis

.vscode/extensions.json

@@ -1,6 +1,5 @@
 {
     "recommendations": [
-        "davelopez.galaxy-tools",
         "mechatroner.rainbow-csv",
         "redhat.vscode-xml",
         "ms-vscode.live-server"

.vscode/tasks.json

@@ -8,6 +8,18 @@
             "type": "shell",
             "command": "planemo lint",
             "problemMatcher": []
+        },
+        {
+            "label": "serve",
+            "type": "shell",
+            "command": "planemo serve",
+            "problemMatcher": []
+        },
+        {
+            "label": "run tests",
+            "type": "shell",
+            "command": "planemo test autobigs-cli.xml --test_output_junit test_results/junit_results.xml --test_output_json test_results/results.json --test_output test_results/human.html",
+            "problemMatcher": []
         }
     ]
 }

Jenkinsfile

@@ -0,0 +1,31 @@
+pipeline {
+    agent {
+        kubernetes {
+            cloud 'rsys-devel'
+            defaultContainer 'pip'
+            inheritFrom 'pip'
+        }
+    }
+    
+    stages {
+        stage ("install") {
+            steps {
+                sh 'pip install -r requirements.txt'
+                sh 'pip install standard-imghdr'
+                sh 'planemo ci_setup'
+            }
+        }
+        stage ("lint") {
+            steps {
+                sh "planemo lint autobigs-cli.xml"
+            }
+        }
+        stage ("test") {
+            steps {
+                sh 'mkdir test_results'
+                sh "planemo test autobigs-cli.xml --test_output_junit test_results/junit_results.xml --test_output_json test_results/results.json --test_output test_results/human.html"
+                xunit checksName: '', tools: [JUnit(excludesPattern: '', pattern: 'test_results/junit_report.xml', stopProcessingIfError: true)]
+            }
+        }
+    }
+}

README.md

@@ -0,0 +1,17 @@
+
+# autoBIGS.Galaxy
+
+A program that allows quickly batched requests for obtaining MLST profiles on multiple FASTA sequences and exporting it as a convenient CSV. Capable of querying a variety of MLST databases from both Institut Pasteur and PubMLST. autoBIGS.galaxy is the galaxy frontend implementation of autoBIGS.cli and autoBIGS.engine.
+
+This Galaxy tool implements [autoBIGS.engine](https://pypi.org/project/autoBIGS.engine) via wrapping the official [autoBIGS.cli](https://github.com/Syph-and-VPD-Lab/autoBIGS.cli) wrapper.
+
+## Features
+
+This CLI is capable of exactly what [autoBIGS.engine](https://pypi.org/project/autoBIGS.engine) is capable of:
+- Import multiple whole genome FASTA files
+- Fetch the available BIGSdb databases that is currently live and available
+- Fetch the available BIGSdb database schemas for a given MLST database
+- Retrieve exact/non-exact MLST allele variant IDs based off a sequence
+- Retrieve MLST sequence type IDs based off a sequence
+- Inexact matches are annotated with an asterisk (\*)
+- Output all results to a single CSV

autobigs-cli.xml

@@ -1,105 +1,142 @@
-<tool id="autobigs-cli" name="AutoBIGS.CLI" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="21.05">
-	<description>Automated MLST typing from PubMLST and InstitutPasteur.</description>
-	<macros>
-		<token name="@TOOL_VERSION@">0.4.3</token>
-		<token name="@VERSION_SUFFIX@">0</token>
-    	<import>autobigs-cli_macros.xml</import>
-	    <expand macro="bio_tools"/>
-	</macros>
+<tool id="autobigs-cli" name="autoBIGS.cli" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="21.05">
+    <description>Automated MLST typing from PubMLST and InstitutPasteur MLST databases.</description>
+    <macros>
+        <token name="@TOOL_VERSION@">0.5.0</token>
+        <token name="@VERSION_SUFFIX@">0</token>
+        <import>autobigs-cli_macros.xml</import>
+        <expand macro="bio_tools"/>
+    </macros>
 
-	<requirements>
-		<requirement type="package" version="@TOOL_VERSION@">autobigs-cli</requirement>
-	</requirements>
+    <requirements>
+        <requirement type="package" version="@TOOL_VERSION@">autobigs-cli</requirement>
+    </requirements>
 
-	<command detect_errors="exit_code"><![CDATA[
-			#if $operation == "info":
-				#if $retrieved == "schema":
-					autoBIGS info $selected_schema
-				#else if $retrieved == "databases":
-					autoBIGS info --retrieve-bigsdbs
-				#end if
-			#else if $operation == "st":
-				autoBIGS st $fastas $seqdefdb $schema $mlst_profiles_output
-			#end if
-	]]></command>
-	<inputs>
-		<conditional name="mode">
-			<param name="operation" label="Operation" type="select">
-				<option value="info"/>
-				<option value="st"/>
-			</param>
-			<when value="info">
-				<conditional name="select-info">
-					<param name="retrieved" label="Schema or Database List" type="select">
-						<option value="schema"/>
-						<option value="databases"/>
-					</param>
-					<when value="schema">
-						<repeat name="schemas" title="Schemas">
-							<param name="selected_schema" argument="--retrieve-bigsdb-schemas" label="Retrieve schemas for" type="integer" min="0"/>
-						</repeat>
-					</when>
-                    <when value="databases">
-                    <!-- No need to do anything -->
+    <command detect_errors="exit_code"><![CDATA[
+            #if $mode.operation == "info":
+                #if $mode.select_info.retrieved == "schemes":
+                    autoBIGS info --retrieve-bigsdb-schemas#for $scheme in $mode.select_info.schemes_list# '${scheme.selected_db}' #end for# --csv $info_schemes_out
+                #else if $mode.select_info.retrieved == "databases":
+                    autoBIGS info --retrieve-bigsdbs --csv $info_db_out
+                #end if
+            #else if $mode.operation == "st":
+                autoBIGS st "$fasta" "$seqdefdb" $schema "$mlst_profiles_output" $stop_on_fail
+            #end if
+    ]]></command>
+    <inputs>
+        <conditional name="mode">
+            <param name="operation" label="Operation" type="select" help="The operational mode of the tool.">
+                <option value="info">Retrieve Database Information</option>
+                <option value="st">Perform Sequence Typing</option>
+            </param>
+            <when value="info">
+                <conditional name="select_info">
+                    <param name="retrieved" label="Retrieve" type="select" help="The type of information should the tool retrieve.">
+                        <option value="schemes">Available Schemes for Database</option>
+                        <option value="databases">Available Databases</option>
+                    </param>
+                    <when value="schemes">
+                        <repeat name="schemes_list" title="Schemes" min="1">
+                            <param name="selected_db" argument="--retrieve-bigsdb-schemas" label="Database Name" type="text" optional="false" help="The name of the database to retrieve schemes for."/>
+                        </repeat>
                     </when>
-				</conditional>
-			</when>
-			<when value="st">
-				<param name="fastas" label="FASTA files" type="data" format="fasta,fas,fa,fna,ffn,faa,mpfa,frn"/>
-				<param name="seqdefdb" label="BIGSdb SeqDef Name" type="text"/>
-				<param name="schema" label="BIGSdb SeqDef Schema ID" type="integer" min="0"/>
-			</when>
-		</conditional>
-	</inputs>
-	<outputs>
-		<data name="mlst_profiles_output" label="${tool.name} on ${on_string}" format="csv">
-			<filter>mode == "st"</filter>
-		</data>
-	</outputs>
+                    <when value="databases">
+
+                    </when>
+                </conditional>
+            </when>
+            <when value="st">
+                <param name="fasta" label="FASTA file" type="data" format="fasta,fas,fa,fna,ffn,faa,mpfa,frn" multiple="true" help="The FASTA(s) file to perform sequence typing on."/>
+                <param name="seqdefdb" label="BIGSdb SeqDef Name" type="text" optional="false" help="The database to use for typing."/>
+                <param name="schema" label="BIGSdb SeqDef Schema ID" type="integer" min="0" help="The (integer) ID of the scheme to be used."/>
+                <param name="stop_on_fail" label="Stop on failure to match" truevalue="--sof" falsevalue="" value="false" type="boolean" help="Stops running on failure to obtain sequence type."/>
+            </when>
+        </conditional>
+    </inputs>
+    <outputs>
+        <data name="mlst_profiles_output" label="${tool.name} on ${on_string}" format="csv">
+            <filter>mode['operation'] == 'st'</filter>
+        </data>
+        <data name="info_db_out" label="${tool.name} supported Databases" format="csv">
+            <filter>mode['operation'] == 'info' and mode['select_info']['retrieved'] == 'databases'</filter>
+        </data>
+        <data name="info_schemes_out" label="${tool.name} supported Schemes" format="csv">
+            <filter>mode['operation'] == 'info' and mode['select_info']['retrieved'] == 'schemes'</filter>
+        </data>
+    </outputs>
     <tests>
-        <test>
+        <test expect_num_outputs="1">
             <param name="operation" value="st" />
-            <param name="fastas" value="tohama_I_bpertussis.fasta" />
+            <param name="fasta" value="tohama_I_minimized_features.fasta" />
             <param name="seqdefdb" value="pubmlst_bordetella_seqdef" />
             <param name="schema" value="3" />
-            <output name="mlst_profiles_output" file="results.csv" ftype="csv" />
+            <output name="mlst_profiles_output" file="tohama_I_minimized_features_typed.csv" ftype="csv" />
+        </test>
+        <test expect_num_outputs="1">
+            <param name="operation" value="info" />
+            <param name="retrieved" value="databases" />
+            <output name="info_db_out">
+                <assert_contents>
+                    <has_text text="BIGSdb Names,Source"/>
+                    <has_text text="pubmlst_bordetella_seqdef,https://bigsdb.pasteur.fr/api"/>
+                </assert_contents>
+            </output>
+        </test>
+        <test expect_num_outputs="1">
+            <param name="operation" value="info" />
+            <repeat name="schemes_list">
+                <param name="selected_db" value="pubmlst_bordetella_seqdef" />
+            </repeat>
+            <output name="info_schemes_out">
+                <assert_contents>
+                    <has_text text="Name,ID"/>
+                    <has_text text="MLST,3"/>
+                </assert_contents>
+            </output>
         </test>
     </tests>
-	<help><![CDATA[
+    <help><![CDATA[
+What is autoBIGS
+================
+autoBIGS is a tool to help automatically performes multi-locus sequence typing (MLST) on given data by performing calls to necessary web BIGS database web APIs.
 
-usage: autoBIGS info [-h] [--retrieve-bigsdbs] [--retrieve-bigsdb-schemas LIST_BIGSDB_SCHEMAS [LIST_BIGSDB_SCHEMAS ...]]
+Tool Modes
+==========
+autoBIGS has two modes. Since the tool works with the sequence definition and MLST databases live, it is also able to tell the user the currently available databases, and their associated schemas. See the following sections for more information.
 
-Fetches the latest BIGSdb MLST database definitions.
+Obtaining Database Name and Schema ID
+=====================================
+You will need a database name and scheme ID for sequence typing. Follow these steps to check what databases, schemes, and their associated IDs are available.
 
-options:
-  -h, --help            show this help message and exit
-  --retrieve-bigsdbs    Lists all known BIGSdb MLST databases (fetched from known APIs and cached).
-  --retrieve-bigsdb-schemas SCHEMA_IDS
-                        Lists the known schema IDs for a given BIGSdb sequence definition database name. The name, and then the ID of the schema is given.
+1. Select "Retrieve Database Information" for "Operation"
+2. Then for "Retrieve" select "Databases" and run. This will produce a table job output with all possible database names and their database API URL. 
+3. Note down the names of the databases you are interested in.
+4. Select "Retrieve Database Information" for "Operation"
+5. Then, for "Retrieve", select "Available schemes for Database".
+6. Enter the noted interested database and run. This will return a CSV with the scheme IDs. Note down interested IDs.
 
-usage: autoBIGS st [-h] [--exact] [--stop-on-fail] fastas [fastas ...] seqdefdb schema out
+Performing Sequence Typing
+==========================
+Simply select "Perform Sequence Typing" for the "Operation" and select your FASTA files. Then, enter your SeqDef Database name (see "Obtaining Database Name and Schema ID" above) and schema ID.
 
-Returns MLST exact profile matches.
+Special behaviour for FASTAs with multiple sequences
+====================================================
+AutoBIGS will treat multiple sequences in the same FASTA file as part of the same sample. This will result in a fasta with multiple sequences within the same row with the final sequence type being retrieved from the resulting alleles of the individual sequences within the FASTA. This is helpful if the input FASTA was obtained from a targetted form of sequencing for the specific needed regions (e.g., Sanger sequencing of 7 house keeping genes), rather than a whole genome sequence. If your data is a whole genome sequence (WGS) of the entire genome or similar, each WGS should have it's own FASTA.
 
-positional arguments:
-  fastas                The FASTA files to process. Multiple can be listed.
-  seqdefdb              The BIGSdb seqdef database to use for typing.
-  schema                The BIGSdb seqdef database schema ID (integer) to use for typing.
-  out                   The output CSV name (.csv will be appended).
-
-options:
-  -h, --help            show this help message and exit
-  --exact, -ex          Should run exact matching rather than returning all similar ones
-  --stop-on-fail, -sof  Should the algorithm stop in the case there are no matches (or partial matches when
-                        expecting exact matches).
+More Information
+================
+For more information on the tool being wrapped itself, please see the `autoBIGS.cli Github repository`_. Issues, bugs, and feature requests for the tool itself should be submitted to the `autoBIGS.cli issues`_. If the issue/bug/feature request is solely pertanent to the Galaxy wrapper, please check out the `autoBIGS.galaxy issues`_ tracker on GitHub.
 
 
-	]]></help>
+.. _autoBIGS.cli GitHub repository: https://github.com/Syph-and-VPD-Lab/autoBIGS.cli
+.. _autoBIGS.cli issues: https://github.com/Syph-and-VPD-Lab/autoBIGS.cli/issues
+.. _autoBIGS.galaxy: https://github.com/Syph-and-VPD-Lab/autoBIGS.galaxy
+.. _autoBIGS.galaxy issues: https://github.com/Syph-and-VPD-Lab/autoBIGS.galaxy/issues
+    ]]></help>
     <citations>
         <citation type="bibtex">
 @book{Deng2025RealYHD,
-title = {RealYHD/autoBIGS.cli},
-url = {https://github.com/RealYHD/autoBIGS.cli},
+title = {Syph-and-VPD-Lab/autoBIGS.cli},
+url = {https://github.com/Syph-and-VPD-Lab/autoBIGS.cli},
 author = {Deng, Harrison},
 date = {2025-01-24},
 year = {2025},

environment.yml

@@ -0,0 +1,7 @@
+name: base
+channels:
+  - bioconda
+  - conda-forge
+dependencies:
+  - python==3.12
+  - planemo

test-data/databases-2025-02-21.csv

@@ -0,0 +1,146 @@
+BIGSdb Names,Source
+pubmlst_aactinomycetemcomitans_seqdef,https://rest.pubmlst.org
+pubmlst_abaumannii_seqdef,https://rest.pubmlst.org
+pubmlst_achromobacter_seqdef,https://rest.pubmlst.org
+pubmlst_aeromonas_seqdef,https://rest.pubmlst.org
+pubmlst_afumigatus_seqdef,https://rest.pubmlst.org
+pubmlst_aparagallinarum_seqdef,https://rest.pubmlst.org
+pubmlst_aphagocytophilum_seqdef,https://rest.pubmlst.org
+pubmlst_arcobacter_seqdef,https://rest.pubmlst.org
+pubmlst_bbacilliformis_seqdef,https://rest.pubmlst.org
+pubmlst_bcc_seqdef,https://rest.pubmlst.org
+pubmlst_bcereus_seqdef,https://rest.pubmlst.org
+pubmlst_bfragilis_seqdef,https://rest.pubmlst.org
+pubmlst_bhenselae_seqdef,https://rest.pubmlst.org
+pubmlst_blastocystis_seqdef,https://rest.pubmlst.org
+pubmlst_blicheniformis_seqdef,https://rest.pubmlst.org
+pubmlst_bmallei_seqdef,https://rest.pubmlst.org
+pubmlst_bordetella_seqdef,https://bigsdb.pasteur.fr/api
+pubmlst_borrelia_seqdef,https://rest.pubmlst.org
+pubmlst_bpseudomallei_seqdef,https://rest.pubmlst.org
+pubmlst_brachyspira_seqdef,https://rest.pubmlst.org
+pubmlst_brucella_seqdef,https://rest.pubmlst.org
+pubmlst_bsubtilis_seqdef,https://rest.pubmlst.org
+pubmlst_bwashoensis_seqdef,https://rest.pubmlst.org
+pubmlst_calbicans_seqdef,https://rest.pubmlst.org
+pubmlst_campylobacter_nonjejuni_seqdef,https://rest.pubmlst.org
+pubmlst_campylobacter_seqdef,https://rest.pubmlst.org
+pubmlst_cbotulinum_seqdef,https://rest.pubmlst.org
+pubmlst_cchauvoei_seqdef,https://rest.pubmlst.org
+pubmlst_cdifficile_seqdef,https://rest.pubmlst.org
+pubmlst_cfreundii_seqdef,https://rest.pubmlst.org
+pubmlst_cglabrata_seqdef,https://rest.pubmlst.org
+pubmlst_chlamydiales_seqdef,https://rest.pubmlst.org
+pubmlst_ckrusei_seqdef,https://rest.pubmlst.org
+pubmlst_cmaltaromaticum_seqdef,https://rest.pubmlst.org
+pubmlst_cperfringens_seqdef,https://rest.pubmlst.org
+pubmlst_cronobacter_seqdef,https://rest.pubmlst.org
+pubmlst_csepticum_seqdef,https://rest.pubmlst.org
+pubmlst_csinensis_seqdef,https://rest.pubmlst.org
+pubmlst_ctropicalis_seqdef,https://rest.pubmlst.org
+pubmlst_diphtheria_seqdef,https://bigsdb.pasteur.fr/api
+pubmlst_dnodosus_seqdef,https://rest.pubmlst.org
+pubmlst_ecloacae_seqdef,https://rest.pubmlst.org
+pubmlst_edwardsiella_seqdef,https://rest.pubmlst.org
+pubmlst_efaecalis_seqdef,https://rest.pubmlst.org
+pubmlst_efaecium_seqdef,https://rest.pubmlst.org
+pubmlst_escherichia_seqdef,https://rest.pubmlst.org
+pubmlst_fpsychrophilum_seqdef,https://rest.pubmlst.org
+pubmlst_gallibacterium_seqdef,https://rest.pubmlst.org
+pubmlst_geotrichum_seqdef,https://rest.pubmlst.org
+pubmlst_hcinaedi_seqdef,https://rest.pubmlst.org
+pubmlst_helicobacter_seqdef,https://rest.pubmlst.org
+pubmlst_hinfluenzae_seqdef,https://rest.pubmlst.org
+pubmlst_hparasuis_seqdef,https://rest.pubmlst.org
+pubmlst_hsuis_seqdef,https://rest.pubmlst.org
+pubmlst_kaerogenes_seqdef,https://rest.pubmlst.org
+pubmlst_klebsiella_seqdef,https://bigsdb.pasteur.fr/api
+pubmlst_koxytoca_seqdef,https://rest.pubmlst.org
+pubmlst_kseptempunctata_seqdef,https://rest.pubmlst.org
+pubmlst_leptospira_seqdef,https://rest.pubmlst.org
+pubmlst_lgarvieae_seqdef,https://rest.pubmlst.org
+pubmlst_liberibacter_seqdef,https://rest.pubmlst.org
+pubmlst_listeria_seqdef,https://bigsdb.pasteur.fr/api
+pubmlst_llactis_phage_seqdef,https://rest.pubmlst.org
+pubmlst_lsalivarius_seqdef,https://rest.pubmlst.org
+pubmlst_mabscessus_seqdef,https://rest.pubmlst.org
+pubmlst_magalactiae_seqdef,https://rest.pubmlst.org
+pubmlst_manserisalpingitidis_seqdef,https://rest.pubmlst.org
+pubmlst_mbovis_seqdef,https://rest.pubmlst.org
+pubmlst_mcanis_seqdef,https://rest.pubmlst.org
+pubmlst_mcaseolyticus_seqdef,https://rest.pubmlst.org
+pubmlst_mflocculare_seqdef,https://rest.pubmlst.org
+pubmlst_mgallisepticum_seqdef,https://rest.pubmlst.org
+pubmlst_mgenitalium_seqdef,https://rest.pubmlst.org
+pubmlst_mhaemolytica_seqdef,https://rest.pubmlst.org
+pubmlst_mhominis_seqdef,https://rest.pubmlst.org
+pubmlst_mhyopneumoniae_seqdef,https://rest.pubmlst.org
+pubmlst_mhyorhinis_seqdef,https://rest.pubmlst.org
+pubmlst_mhyosynoviae_seqdef,https://rest.pubmlst.org
+pubmlst_miowae_seqdef,https://rest.pubmlst.org
+pubmlst_mplutonius_seqdef,https://rest.pubmlst.org
+pubmlst_mpneumoniae_seqdef,https://rest.pubmlst.org
+pubmlst_msciuri_seqdef,https://rest.pubmlst.org
+pubmlst_msynoviae_seqdef,https://rest.pubmlst.org
+pubmlst_mycobacteria_seqdef,https://rest.pubmlst.org
+pubmlst_neisseria_seqdef,https://rest.pubmlst.org
+pubmlst_oralstrep_seqdef,https://rest.pubmlst.org
+pubmlst_orhinotracheale_seqdef,https://rest.pubmlst.org
+pubmlst_otsutsugamushi_seqdef,https://rest.pubmlst.org
+pubmlst_pacnes_seqdef,https://rest.pubmlst.org
+pubmlst_paeruginosa_seqdef,https://rest.pubmlst.org
+pubmlst_pdamselae_seqdef,https://rest.pubmlst.org
+pubmlst_pfluorescens_seqdef,https://rest.pubmlst.org
+pubmlst_pgingivalis_seqdef,https://rest.pubmlst.org
+pubmlst_plarvae_seqdef,https://rest.pubmlst.org
+pubmlst_plasmid_seqdef,https://rest.pubmlst.org
+pubmlst_pmultocida_seqdef,https://rest.pubmlst.org
+pubmlst_ppentosaceus_seqdef,https://rest.pubmlst.org
+pubmlst_pputida_seqdef,https://rest.pubmlst.org
+pubmlst_proteus_seqdef,https://rest.pubmlst.org
+pubmlst_psalmonis_seqdef,https://rest.pubmlst.org
+pubmlst_ranatipestifer_seqdef,https://rest.pubmlst.org
+pubmlst_rhodococcus_seqdef,https://rest.pubmlst.org
+pubmlst_rmlst_seqdef,https://rest.pubmlst.org
+pubmlst_sagalactiae_seqdef,https://rest.pubmlst.org
+pubmlst_salmonella_seqdef,https://rest.pubmlst.org
+pubmlst_saureus_seqdef,https://rest.pubmlst.org
+pubmlst_sbsec_seqdef,https://rest.pubmlst.org
+pubmlst_scanis_seqdef,https://rest.pubmlst.org
+pubmlst_schromogenes_seqdef,https://rest.pubmlst.org
+pubmlst_sdysgalactiae_seqdef,https://rest.pubmlst.org
+pubmlst_sepidermidis_seqdef,https://rest.pubmlst.org
+pubmlst_serratia_seqdef,https://rest.pubmlst.org
+pubmlst_sgallolyticus_seqdef,https://rest.pubmlst.org
+pubmlst_shaemolyticus_seqdef,https://rest.pubmlst.org
+pubmlst_shewanella_seqdef,https://rest.pubmlst.org
+pubmlst_shominis_seqdef,https://rest.pubmlst.org
+pubmlst_siniae_seqdef,https://rest.pubmlst.org
+pubmlst_sinorhizobium_seqdef,https://rest.pubmlst.org
+pubmlst_smaltophilia_seqdef,https://rest.pubmlst.org
+pubmlst_smitis_seqdef,https://rest.pubmlst.org
+pubmlst_sparasitica_seqdef,https://rest.pubmlst.org
+pubmlst_spneumoniae_seqdef,https://rest.pubmlst.org
+pubmlst_spseudintermedius_seqdef,https://rest.pubmlst.org
+pubmlst_spyogenes_seqdef,https://rest.pubmlst.org
+pubmlst_ssuis_seqdef,https://rest.pubmlst.org
+pubmlst_sthermophilus_seqdef,https://rest.pubmlst.org
+pubmlst_streptomyces_seqdef,https://rest.pubmlst.org
+pubmlst_suberis_seqdef,https://rest.pubmlst.org
+pubmlst_szooepidemicus_seqdef,https://rest.pubmlst.org
+pubmlst_taylorella_seqdef,https://rest.pubmlst.org
+pubmlst_tenacibaculum_seqdef,https://rest.pubmlst.org
+pubmlst_test_seqdef,https://rest.pubmlst.org
+pubmlst_tpallidum_seqdef,https://rest.pubmlst.org
+pubmlst_tvaginalis_seqdef,https://rest.pubmlst.org
+pubmlst_ureaplasma_seqdef,https://rest.pubmlst.org
+pubmlst_vcholerae_seqdef,https://rest.pubmlst.org
+pubmlst_vibrio_seqdef,https://rest.pubmlst.org
+pubmlst_vparahaemolyticus_seqdef,https://rest.pubmlst.org
+pubmlst_vtapetis_seqdef,https://rest.pubmlst.org
+pubmlst_vvulnificus_seqdef,https://rest.pubmlst.org
+pubmlst_wolbachia_seqdef,https://rest.pubmlst.org
+pubmlst_xcitri_seqdef,https://rest.pubmlst.org
+pubmlst_xfastidiosa_seqdef,https://rest.pubmlst.org
+pubmlst_yersinia_seqdef,https://bigsdb.pasteur.fr/api
+pubmlst_yruckeri_seqdef,https://rest.pubmlst.org

test-data/results.csv

@@ -1,2 +0,0 @@
-id,st,clonal-complex,tyrB,icd,pepA,adk,pgm,fumC,glyA
-BX470248.1,1,ST-2 complex,1,1,1,1,1,1,1

test-data/schemas-2025-02-21.csv

@@ -0,0 +1,11 @@
+Name,ID
+Autotransporters,11
+Bp_vaccine antigens,7
+MLST,3
+Other toxins,9
+PRN-test-Bp,5
+Phase,8
+T3SS,10
+cgMLST_genus,1
+cgMLST_pertussis,4
+macrolide resistance,6

test-data/tohama_I_bpertussis_wgs_typed.csv

@@ -0,0 +1,2 @@
+id,st,clonal-complex,adk,fumC,glyA,icd,pepA,pgm,tyrB
+BX470248.1,1,ST-2 complex,1,1,1,1,1,1,1

test-data/tohama_I_minimized_features.fasta

@@ -0,0 +1,133 @@
+>lcl|BX640419.1_cds_CAE43044.1_2724 [gene=adK] [locus_tag=BP2769] [db_xref=GOA:P0DKX8,InterPro:IPR000850,InterPro:IPR006259,InterPro:IPR007862,InterPro:IPR027417] [protein=adenylate kinase] [protein_id=CAE43044.1] [location=164032..164688] [gbkey=CDS]
+ATGCGTCTCATTCTGCTCGGACCGCCCGGAGCCGGCAAAGGCACCCAAGCCGCCTTTCTCACCCAACACT
+ACGGCATCCCGCAGATATCCACCGGTGACATGCTGCGCGCCGCCGTCAAGGCCGGCACGCCGCTGGGCCT
+GGAAGCCAAGAAGGTCATGGACGCGGGCGGCCTGGTCTCGGACGACCTGATCATCGGCCTGGTGCGCGAT
+CGCCTGACCCAGCCCGATTGCGCCAACGGCTACCTGTTCGACGGTTTCCCGCGCACCATCCCGCAGGCCG
+ACGCGCTCAAGAGCGCCGGCATCGCGCTGGATTACGTGGTCGAGATCGAAGTGCCGGAAAGCGACATCAT
+CGAACGCATGAGCGAACGCCGCGTGCACCCGGCCAGCGGCCGCAGCTACCACGTACGCTTCAATCCGCCC
+AAGGCCGAAGGCGTGGACGACGTCACGGGCGAACCGCTGGTGCAGCGCGACGACGACCGCGAGGAAACCG
+TGCGCCATCGTCTCAACGTCTACCAGAACCAGACCCGCCCGCTGGTCGACTACTACTCGTCCTGGGCCCA
+GTCCGATGCCGCCGCGGCGCCCAAGTACCGCAAGATCTCCGGCGTCGGCTCGGTCGACGAAATCAAGAGC
+CGCCTGTCGCAGGCTCTGCAGAGCTAA
+>lcl|BX640411.1_cds_CAE40628.1_248 [gene=fumC] [locus_tag=BP0248] [db_xref=GOA:Q7W0A2,InterPro:IPR000362,InterPro:IPR005677,InterPro:IPR008948,InterPro:IPR018951,InterPro:IPR020557,InterPro:IPR022761,InterPro:IPR024083] [protein=fumarate hydratase class II] [protein_id=CAE40628.1] [location=256543..257934] [gbkey=CDS]
+ATGAAAACCCGCACCGAAAAAGACACTTTCGGCCCGATCGAGGTGCCCGAGCAGCACCTGTGGGGCGCGC
+AGACCCAGCGCTCGCTGCATTTCTTCGCGATCTCGACCGAGAAGATGCCGGTGCCGCTGGTCGCCGCCAT
+GGCACGCCTGAAGCGCGCCGCCGCCAAGGTCAACGCCGAGCTGGGCGAGCTGGATCCGCAGGTCGCAGAC
+GCCATCATGCGGGCCGCCGATGAGGTGATCGCCGGCAAGTGGCCCGACGAGTTTCCGCTGTCGGTCTGGC
+AGACCGGCTCGGGCACGCAGAGCAACATGAACATGAACGAGGTGCTGGCCAACCGCGCCTCCGAGCTGCT
+GGGCGGCGAGCGCGGCGAAGGCCGCAAGGTGCACCCCAACGACCACGTGAACCGGGGCCAGTCGTCCAAC
+GATACCTTTCCGACCGCCATGCACGTGGCCGCCGCGGTCGAGGTCGAGCACCGCGTGCTGCCCGCCCTGA
+AGGCGTTGCGCGGCACGCTGGCCGCCAAGAGCGCGGCGTTCTACGACATCGTCAAGATCGGTCGCACCCA
+TTTGCAGGACGCCACCCCGTTGACGCTGGGCCAGGAGATCTCCGGCTACGTGGCGCAGCTGGACCTGGCC
+GAGCAGCAGATCCGCGCGACGCTGGCCGGCCTGCACCAGCTGGCCATCGGCGGCACGGCGGTGGGCACCG
+GCCTGAACGCGCATCCGCAGTTCAGCGCCAAGGTATCGGCCGAACTGGCCCATGACACGGGCAGCGCGTT
+CGTGTCGGCGCCCAACAAGTTCCAGGCGCTGGCTTCGCACGAGGCGCTGCTGTTCGCGCACGGCGCCTTG
+AAGACGCTGGCCGCCGGCCTGATGAAGATCGCCAACGATGTGCGCTGGCTGGCCAGCGGCCCGCGCTCGG
+GGCTGGGCGAAATCAGCATTCCCGAGAACGAGCCGGGCAGCTCCATCATGCCGGGCAAGGTCAACCCGAC
+CCAGTGCGAAGCCGTCACGATGCTGGCCGCGCAGGTCATGGGCAACGACGTGGCCATCAATGTCGGCGGG
+GCCAGCGGCAACTTCGAGCTGAACGTCTTCAAGCCGCTGGTGATCCACAATTTCCTGCAGTCGGTGCGCC
+TGCTGGCCGACGGCATGGTCAGCTTCGACAAGCACTGCGCGGCCGGCATCGAGCCCAACCGCGAGCGCAT
+CACCGAGCTGGTCGAGCGTTCGCTGATGCTGGTGACTGCGCTCAACCCGCACATCGGCTACGACAAGGCC
+GCGCAGATCGCCAAGAAGGCGCACAAGGAAAACCTGTCGCTGAAAGAGGCGGCGCTGGCGCTGGGGCACC
+TGACCGAGGCGCAGTTCGCCGAGTGGGTGGTGCCGGGCGACATGACCAACGCGCGCCGCTAG
+>lcl|BX640420.1_cds_CAE43224.1_2904 [gene=glyA] [locus_tag=BP2952] [db_xref=GOA:Q7VUW7,InterPro:IPR001085,InterPro:IPR015421,InterPro:IPR015422,InterPro:IPR015424,InterPro:IPR019798] [protein=serine hydroxymethyltransferase] [protein_id=CAE43224.1] [location=complement(8611..9858)] [gbkey=CDS]
+ATGTTCAACCGCAACCTGACCCTCGACCAGGTGGATCCCGACGTCTGGGCCGCCATCCAGAAAGAAGACG
+TACGCCAGGAACAGCACATCGAGCTGATCGCGTCCGAGAACTACGCCAGCCCCGCCGTGATGCAGGCCCA
+GGGCACGCAACTGACCAACAAGTATGCGGAAGGCTACCCGGGCAAGCGCTACTACGGCGGTTGCGAGTAC
+GTCGACGTGGTCGAGCAGCTGGCCATCGACCGCCTGAAGCAGATTTTCGGCGCCGAGGCCGCCAACGTGC
+AGCCGAACTCCGGCTCGCAGGCCAACCAGGGCGTGTACATGGCGGTGCTCAAGCCGGGCGATACCGTGCT
+GGGCATGAGCCTGGCCGAAGGCGGTCACCTGACGCACGGCGCGTCGGTCAACGCCTCGGGCAAGCTGTAC
+AACTTCGTGCCCTACGGCCTGGACGCCGACGAGGTGCTGGACTACGCCCAGGTCGAGCGGCTGACCAAGG
+AACACAAGCCCAAGCTGATCGTGGCCGGCGCCTCCGCGTACGCGCTGCACATCGACTTCGAGCGCATGGC
+GCGCATCGCCCACGACAACGGCGCGCTGTTCATGGTGGACATCGCCCACTATGCCGGCCTGGTGGCCGGC
+GGCGCCTATCCCAACCCGGTGCCGCACGCCGATTTCGTCACCTCCACCACGCACAAGTCGCTGCGCGGCC
+CGCGCGGCGGCGTCATCATGATGAAGGCCGAGTTCGAGAAGGCCGTCAATTCGGCCATCTTCCCGGGCAT
+CCAGGGCGGTCCGCTGATGCACGTCATCGCGGCCAAGGCCGTGGCCTTCAAGGAAGCGCTGTCGCCCGAG
+TTCCAGGATTACGCCCAGCAGGTCGTCAAGAACGCCAAGGTGCTGGCCGATACGCTGGTCAAGCGCGGCC
+TGCGCATCGTGTCGGGCAGGACCGAAAGCCACGTCATGCTGGTGGACCTGCGTCCCAAGGGCATTACCGG
+CAAGGAAGCGGAAGCGGTGCTGGGCCAGGCCCACATCACGGTCAACAAGAACGCCATTCCCAACGACCCG
+GAAAAGCCCTTCGTGACCAGCGGCATCCGCCTGGGCACTCCGGCCATGACCACCCGCGGCTTCAAGGAGG
+CCGAGGCCGAGCTGACCGCCAACCTGATCGCCGACGTGCTGGACAATCCGCGCGACGAGGCGAACATCGC
+CGCGGTGCGCGCGCGGGTCAATGAACTGACCGCCCGCCTGCCCGTCTACGGCAACTGA
+>lcl|BX640418.1_cds_CAE42760.1_2440 [gene=icd] [locus_tag=BP2488] [db_xref=GOA:Q7VVZ2,InterPro:IPR001804,InterPro:IPR004439,InterPro:IPR019818,InterPro:IPR024084,UniProtKB/TrEMBL:Q7VVZ2] [protein=isocitrate dehydrogenase [NADP]] [protein_id=CAE42760.1] [location=complement(204636..205892)] [gbkey=CDS]
+ATGTCCTATCAACATATCAAGGTTCCCACTGGGGGCCAAAAAATCACGGTCAACGCCGATTACTCGCTGA
+ATGTGCCCGATCAGGTCATCATTCCGGTCATCGAGGGTGACGGTACGGGCGCCGACATCACGCCGGTGAT
+GATTAAGGTCGTCGACGCGGCCGTGCAGAAGGCCTATGCGGGCAAGCGCAAGATCCACTGGATGGAAGTC
+TACGCCGGCGAGAAGGCCACCAAGGTCTACGGCCCGGACGTCTGGCTGCCCGAGGAAACCCTCGACGCCG
+TCAAGGACTACGTGGTGTCGATCAAGGGTCCGCTGACCACGCCGGTCGGCGGCGGCATCCGTTCGCTGAA
+CGTGGCGCTGCGCCAGCAGCTGGACCTGTATGTCTGCCTGCGCCCGGTGCGCTACTTCAAGGGCGTGCCC
+TCGCCGGTGCGCGAGCCCGAGAAGACCGACATGGTCATCTTCCGCGAGAACTCGGAAGACATCTACGCGG
+GCATCGAGTACATGGCCGAGTCCGAGCAGGCCAAGGACCTGATCCAGTACCTGCAGACCAAGCTGGGCGT
+GACCAAGATCCGCTTCCCGAACACCTCGTCGATCGGCATCAAGCCGGTTTCGCGCGAAGGCACCGAGCGC
+CTGGTGCGCAAGGCGCTGCAGTACGCCATCGACAATGACCGCGCCTCGGTGACCCTGGTCCACAAGGGCA
+ACATCATGAAGTTCACGGAAGGCGGCTTCCGCGACTGGGGCTACGCCCTGGCCCAGAACGAGTTCGGCGC
+GCAGCCGATCGACGGCGGCCCGTGGTGCAAGTTCAAGAATCCCAAGACGGGTCGCGAGATCATCGTCAAG
+GATTCGATCGCCGACGCCTTCCTGCAGCAGATCCTGCTGCGTCCGGCCGAATACGACGTGATCGCCACGC
+TGAACCTGAACGGCGACTACATCTCCGACGCGCTGGCCGCGCAAGTGGGCGGCATCGGCATTGCCCCGGG
+CGCCAACCTGTCGGATTCCGTGGCCATGTTCGAAGCCACCCACGGCACCGCGCCGAAGTACGCGGGCAAG
+GACTACGTGAACCCCGGTTCCGAAATCCTGTCGGCCGAAATGATGCTGCGCCACATGGGCTGGACCGAGG
+CCGCCGACCTGATCATCGCCAGCATGGAGAAATCCATCCTGTCCAAGAAGGTCACCTATGACTTCGCCCG
+TCTGCTCGAAGGCGCCACCCAGGTGTCGTGCTCGGGCTTCGGTCAGGTCATGATCGACAATATGTAA
+>lcl|BX640418.1_cds_CAE42692.1_2372 [gene=pepA] [locus_tag=BP2421] [db_xref=GOA:Q7VW48,InterPro:IPR000819,InterPro:IPR008283,InterPro:IPR011356,InterPro:IPR023042] [protein=cytosol aminopeptidase] [protein_id=CAE42692.1] [location=131847..133346] [gbkey=CDS]
+ATGGAATTTAGCACACAGACCACTGCCTCCCTGCATCAGATCAAGACTGCGGCCCTGGCCGTCGGCGTCT
+TCGCCGACGGCGTGCTCAGCGCCGCCGCCGAAGTCATCGACCGCGCCAGCCACGGTGCCGTGGCCGCCGT
+GGTGAAAAGCGAGTTCCGCGGCCGCACCGGCAGCACGCTGGTGCTGCGCAGCCTGGCCGGCGTCAGCGCC
+CAGCGCGTGGTGCTGGTGGGCCTGGGCAAGCAGGCCGAATACAACGCCCGCGCGCACGCCAGCGCCGAAC
+AGGCGTTCGCCGCGGCGTGCGTCGCGGCCCAGGTGGGCGAAGGCGTGTCGACCCTGGCCGGCGTGGCCAT
+CGAGGGCGTGCCGGTGCGCGCCCGCGCGCGCAGCGCCGCCATCGCCGCGGGCGCGGCGGCCTACCATTAC
+GATGCGACGTTCGGCAAGGCCAATCGCGACGCCCGCCCCAGGTTGAAGAAAATCGTCCAGGTGGTCGACC
+GCGCGGCCTCCGCGCAGGCGCAGCTGGGCCTGCGCGAAGGCGCGGCCATCGCCCACGGCATGGAATTGAC
+CCGCACGCTGGGCAACCTGCCCGGCAACGTGTGCACGCCGGCCTATCTCGGCAATACCGCCAAGAAACTG
+GCGCGCGAATTCAAGAGCCTCAAGGTCGAGGTGCTCGAACGCAAGCAGGTCGAGGCGCTGGGCATGGGCT
+CGTTCCTCTCGGTCGCGCGCGGCTCGGAAGAACCGCTGCGCTTCATCGTGCTGCGCCATGCCGGCAAGCC
+CGCCAAGAAGGACAAGGCCGGCCCGGTCGTCCTGGTGGGCAAGGGCATCACCTTCGATGCTGGCGGCATC
+TCGCTCAAGCCGGCCGCCACGATGGACGAAATGAAGTACGACATGTGCGGCGCGGCCAGCGTGCTGGGCA
+CGTTCCGCGCCCTGGCCGAGCTGGAGCTGCCGCTGGATGTGGTGGGCCTGATCGCGGCGTGCGAGAACCT
+GCCCAGCGGCAAGGCCAACAAGCCCGGCGACGTGGTCACCAGCATGTCGGGCCAGACCATCGAGATCCTC
+AACACCGACGCCGAAGGCCGCCTGGTGCTGTGCGATGCCCTGACCTACGCCGAGCGCTTCAAGCCCGCGG
+CCGTGATCGACATCGCCACGTTGACCGGCGCCTGCGTGGTAGCCCTGGGCAACGTCAATAGCGGCCTGTT
+CTCCAAGGACGACGCGCTGGCCGACGCGCTGCTGGCCGCCAGCCGCCAGTCGCTCGACCCGGCCTGGCGC
+CTGCCGCTGGACGATGCCTACCAGGACCAGCTCAAGTCCAACTTCGCCGACATCGCCAACATCGGCGGCC
+CCCCGGCCGGCGCGGTCACGGCGGCCTGCTTCCTGTCGCGCTTCACCAAGGCTTATCCGTGGGCGCACCT
+GGACATCGCCGGCACGGCCTGGCGCGGCGGCAAGGACAAGGGCGCCACCGGCCGGCCGGTGCCGCTGCTG
+ATGCAGTACCTGCTGGACCAGGCAGGCTGA
+>lcl|BX640420.1_cds_CAE43408.1_3088 [gene=pgm] [locus_tag=BP3141] [db_xref=GOA:Q7VUF5,InterPro:IPR005841,InterPro:IPR005843,InterPro:IPR005844,InterPro:IPR005845,InterPro:IPR005846,InterPro:IPR016055,InterPro:IPR016066,UniProtKB/TrEMBL:Q7VUF5] [protein=phosphoglucomutase] [protein_id=CAE43408.1] [location=217601..218983] [gbkey=CDS]
+GTGGCGCACCCCTTTCCCGCATCGGTCTACAAGGCGTACGACATCCGTGGCTCGGTTCCCGACCAGCTCG
+ACCCGGTATTCGCCCGGGCGCTGGGCCGCGCCCTGGCCGCCAGCGCCCGCGCGCAGGGCATCGGCGCCCT
+GGTGGTCGGCCGCGACGGCCGCCTGAGCAGCCCCGACCTGGCCGGCGCGCTGCAGGAAGGCATCATGGAA
+GGCGGCGTGGACACCCTGGACATCGGCCAGGTGCCCACGCCGCTGGTCTATTTCGCGGCGCACATCCAGG
+GCACGGGCTCGGGCGTGGCGGTCACCGGCAGCCACAACCCGCCGCAGTACAACGGCTTCAAGATGATGAT
+GGGCGGCCAGGCCCTGTACGGCCCGGCCGTGCAGGCGCTGCGCCCGGCCATGCTGGCGCCGGCTGCGGCG
+CCGGGCACCTGGGGCGAACGCCGCCAGCTCGATGTCGTCCCCGCCTATATCGAGCGCATCGTGTCCGACG
+TGAAGCTGGCGCGCCCCATGAAGATCGCCGTCGACTGCGGCAATGGCGTGGCCGGCGCCCTGGCGCCGCA
+ACTGTTCCGCGCGCTGGGTTGCGAAGTGGACGAGCTCTATTGCGAGGTCGACGGCACGTTTCCCAACCAC
+CATCCCGACCCGGCCGAACCGCGCAACCTGCAGGACCTGATCGCCCATGTCACCAGCACCGACTGCGAGC
+TGGGCCTGGCCTTCGACGGCGACGGCGACCGCCTCGGCGTGGTGACCAAGTCCGGCCAGATCATCTGGCC
+CGACCGCCAGCTGATCCTGTTCGCCCGCGACGTGCTGGCCCGCTGTCCCGGCGCGACCATCATCTATGAC
+GTCAAGTGCAGCCAGCACGTGGGCGTGGCCATCGAGCAAAGCGGCGGCGTGCCGCTGATGTGGCAGACTG
+GCCATTCGCTGGTGAAGGCCAAGCTGGCCGAGACCGGCGCGCCGCTGGCCGGCGAGATGAGCGGCCATAT
+CTTCTTCAAGGAGCGCTGGTACGGCTTCGACGACGGCCTGTACACCGGCGCCCGCCTGCTGGAAATCGTC
+TCCCGCGAAACCGATGCGTCGCGCCCGCTGGAGGCCCTGCCGCAGGCGCTGTCGACCCCCGAGCTCAAGC
+TGGAGATGGCCGAGGGCGAGCCGCATGCGCTGATCGCCGCCCTGCAGCAGCAGGGCGAGTTCGCCAGCGC
+CAGCCGGCTGGTTACGATAGACGGCGTGCGCGCGGAATACCCGGACGGCTTCGGGCTGGCGCGCGCCTCC
+AATACCACCCCCGTCGTCGTGCTGCGCTTCGAAGCGGAGACCGAGCCGGGCCTGGCCCGCATCCAGCAGG
+AATTCCGCCAGCAGCTGCTGCGGCTGGCTCCGCAAGCCAAACTGCCCTTCTGA
+>lcl|BX640416.1_cds_CAE42081.1_1761 [gene=tyrB] [locus_tag=BP1795] [db_xref=GOA:Q7VXH5,InterPro:IPR000796,InterPro:IPR004838,InterPro:IPR004839,InterPro:IPR015421,InterPro:IPR015424,UniProtKB/TrEMBL:Q7VXH5] [protein=aromatic-amino-acid aminotransferase] [protein_id=CAE42081.1] [location=complement(151299..152501)] [gbkey=CDS]
+ATGAGCACTCTTTTCGCTTCCGTCGAACTCGCGCCGCGCGACCCCATTCTTGGCCTGAACGAACAGTACA
+ACGCCGATACCCGTCCCGGCAAAGTGAACCTGGGCGTGGGCGTGTACTACGACGACGAAGGCCGCATCCC
+GCTGCTTCAGGCCGTGCGCAAGGCCGAGGTGGCCCGCATCGAAGCCGCCGCCGCCCGCGGCTATCTGCCG
+ATCGAAGGCATCGCGGGGTACAACAAGGGTGCGCAGGCGCTGCTGCTGGGCGCCGACTCGCCGCTGGCCG
+CCGAAGGCCGCGTGCTGACCGCGCAGGCCCTGGGCGGCACCGGCGCGCTGAAGATCGGCGCCGACTTCCT
+GCGCCAGCTGCTGCCGCAGTCCAAGGTCCTCATCAGCGACCCCAGCTGGGAAAACCACCGCGCCCTGTTC
+GAGCGCGCCGGCTTCCCGGTCGAGACCTACGCTTATTACGATGCCGCCACCCATGGCCTGAACTTCGAAG
+CCATGCTGGCCGCCCTGCAGGCCGCGCCCGAACAGACCATCGTGGTGCTGCACGCCTGCTGCCACAACCC
+GACCGGCGTCGATCCCACGCCGCAACAGTGGGAACAGATCGCCGCCGTGGTCAAGGCGCGCAACCTGGTG
+CCGTTCCTCGACATCGCCTACCAGGGCTTCGGCGAAGGCCTGGAGCAGGACGCCGCCGTGGTGCGCATGT
+TCGCCGCGCTCGACCTGACCATGTTCATCAGCTCGTCGTTCTCCAAGTCCTTCTCGCTGTATGGCGAGCG
+GGTCGGGGCCCTGACCGTGGTGGCCGGCAGCAAGGACGAGGCCGCCCGCGTGCTCAGCCAGCTCAAGCGC
+GTGATCCGCACCAACTACTCCAACCCGCCCACCCACGGCGGCACCGTGGTGTCCACGGTCCTGAACACAC
+CCGAGCTGTTCGCGCTCTGGGAAAATGAACTGGCCGGCATGCGCGACCGCATCCGCCTGATGCGCAAGGA
+GCTGGTCGAGAAGATCAAGACCCAGGGCGTGGCGCAGGACTTCAGCTTCGTGCTGGCGCAGCGCGGCATG
+TTCTCGTACTCGGGCCTGACCGCCGCCCAGGTCGATCGCCTGCGCGAAGAGCACGGCATCTACGCGGTCT
+CCAGCGGCCGCATCTGCGTGGCCGCGCTCAACAGCCGCAACATCGACGCGGTCGCGGCCGGCATCGCCGC
+GGTGCTGAAGTAG

test-data/tohama_I_minimized_features_typed.csv

@@ -0,0 +1,2 @@
+id,st,clonal-complex,adk,fumC,glyA,icd,pepA,pgm,tyrB
+lcl|BX640419.1_cds_CAE43044.1_2724-lcl|BX640411.1_cds_CAE40628.1_248-lcl|BX640420.1_cds_CAE43224.1_2904-lcl|BX640418.1_cds_CAE42760.1_2440-lcl|BX640418.1_cds_CAE42692.1_2372-lcl|BX640420.1_cds_CAE43408.1_3088-lcl|BX640416.1_cds_CAE42081.1_1761,1,ST-2 complex,1,1,1,1,1,1,1