Multiple string profiling now respects grouped queries (for non-WGS)

README.md

@@ -1,6 +1,6 @@
 # autoBIGS.Engine
 
-A python library implementing common BIGSdb MLST schemes and databases. Implementation follows the RESTful API outlined by the official [BIGSdb documentation](https://bigsdb.readthedocs.io/en/latest/rest.html) up to `V1.50.0`.
+A python library implementing common BIGSdb MLST schemes and databases accesses for the purpose of typing sequences automatically. Implementation follows the RESTful API outlined by the official [BIGSdb documentation](https://bigsdb.readthedocs.io/en/latest/rest.html) up to `V1.50.0`.
 
 ## Features
 

pyproject.toml

@@ -13,11 +13,12 @@ dependencies = [
 ]
 requires-python = ">=3.12"
 description = "A library to rapidly fetch fetch MLST profiles given sequences for various diseases."
+license = {text = "GPL-3.0-or-later"}
 
 [project.urls]
-Homepage = "https://github.com/RealYHD/autoBIGS.engine"
-Source = "https://github.com/RealYHD/autoBIGS.engine"
-Issues = "https://github.com/RealYHD/autoBIGS.engine/issues"
+Homepage = "https://github.com/Syph-and-VPD-Lab/autoBIGS.engine"
+Source = "https://github.com/Syph-and-VPD-Lab/autoBIGS.engine"
+Issues = "https://github.com/Syph-and-VPD-Lab/autoBIGS.engine/issues"
 
 [tool.setuptools_scm]
 

src/autobigs/engine/analysis/bigsdb.py

@@ -11,7 +11,6 @@ from typing import Any, AsyncGenerator, AsyncIterable, Iterable, Mapping, Sequen
 
 from aiohttp import ClientSession, ClientTimeout
 
-from autobigs.engine.analysis.aligners import AsyncBiopythonPairwiseAlignmentEngine
 from autobigs.engine.reading import read_fasta
 from autobigs.engine.structures.alignment import PairwiseAlignment
 from autobigs.engine.structures.genomics import NamedString
@@ -125,13 +124,17 @@ class RemoteBIGSdbMLSTProfiler(BIGSdbMLSTProfiler):
 
     async def profile_multiple_strings(self, query_named_string_groups: AsyncIterable[Iterable[NamedString]], stop_on_fail: bool = False) -> AsyncGenerator[NamedMLSTProfile, Any]:
         async for named_strings in query_named_string_groups:
+            names: list[str] = list()
+            sequences: list[str] = list()
             for named_string in named_strings:
+                names.append(named_string.name)
+                sequences.append(named_string.sequence)
             try:
-                    yield NamedMLSTProfile(named_string.name, (await self.profile_string([named_string.sequence])))
+                yield NamedMLSTProfile("-".join(names), (await self.profile_string(sequences)))
             except NoBIGSdbMatchesException as e:
                 if stop_on_fail:
                     raise e
-                    yield NamedMLSTProfile(named_string.name, None)
+                yield NamedMLSTProfile("-".join(names), None)
 
     async def close(self):
         await self._http_client.close()

src/autobigs/engine/reading.py

@@ -5,12 +5,13 @@ from Bio import SeqIO
 
 from autobigs.engine.structures.genomics import NamedString
 
-async def read_fasta(handle: Union[str, TextIOWrapper]) -> AsyncGenerator[NamedString, Any]:
+async def read_fasta(handle: Union[str, TextIOWrapper]) -> Iterable[NamedString]:
     fasta_sequences = asyncio.to_thread(SeqIO.parse, handle=handle, format="fasta")
+    results = []
     for fasta_sequence in await fasta_sequences:
-        yield NamedString(fasta_sequence.id, str(fasta_sequence.seq))
+        results.append(NamedString(fasta_sequence.id, str(fasta_sequence.seq)))
+    return results
 
-async def read_multiple_fastas(handles: Iterable[Union[str, TextIOWrapper]]) -> AsyncGenerator[NamedString, Any]:
+async def read_multiple_fastas(handles: Iterable[Union[str, TextIOWrapper]]) -> AsyncGenerator[Iterable[NamedString], Any]:
     for handle in handles:
-        async for named_seq in read_fasta(handle):
-            yield named_seq
+        yield await read_fasta(handle)

src/autobigs/engine/writing.py

@@ -6,13 +6,15 @@ from typing import AsyncIterable, Collection, Mapping, Sequence, Union
 from autobigs.engine.structures.mlst import Allele, MLSTProfile
 
 
-def alleles_to_map(alleles: Collection[Allele]) -> Mapping[str, Union[list[str], str]]:
+def alleles_to_text_map(alleles: Collection[Allele]) -> Mapping[str, Union[Sequence[str], str]]:
     result = defaultdict(list)
     for allele in alleles:
-        result[allele.allele_locus].append(allele.allele_variant)
+        result[allele.allele_locus].append(allele.allele_variant + ("*" if allele.partial_match_profile is not None else ""))
     for locus in result.keys():
         if len(result[locus]) == 1:
             result[locus] = result[locus][0] # Take the only one
+        else:
+            result[locus] = tuple(result[locus]) # type: ignore
     return dict(result)
 
 async def write_mlst_profiles_as_csv(mlst_profiles_iterable: AsyncIterable[tuple[str, Union[MLSTProfile, None]]], handle: Union[str, bytes, PathLike[str], PathLike[bytes]]) -> Sequence[str]:
@@ -24,7 +26,7 @@ async def write_mlst_profiles_as_csv(mlst_profiles_iterable: AsyncIterable[tuple
             if mlst_profile is None:
                 failed.append(name)
                 continue
-            allele_mapping = alleles_to_map(mlst_profile.alleles)
+            allele_mapping = alleles_to_text_map(mlst_profile.alleles)
             if writer is None:
                 header = ["id", "st", "clonal-complex", *sorted(allele_mapping.keys())]
                 writer = csv.DictWriter(filehandle, fieldnames=header)

tests/autobigs/engine/analysis/test_bigsdb.py

@@ -50,17 +50,17 @@ bpertussis_tohamaI_bad_profile = MLSTProfile((
         Allele("pgm", "5", None),
     ), "unknown", "unknown")
 
-hinfluenzae_fdaargos_profile = MLSTProfile((
-        Allele("adk", "1", None),
-        Allele("atpG", "1", None),
-        Allele("frdB", "1", None),
-        Allele("fucK", "1", None),
-        Allele("mdh", "1", None),
-        Allele("pgi", "1", None),
-        Allele("recA", "5", None)
-    ), "3", "ST-3 complex")
+hinfluenzae_2014_102_profile = MLSTProfile((
+        Allele("adk", "28", None),
+        Allele("atpG", "33", None),
+        Allele("frdB", "7", None),
+        Allele("fucK", "18", None),
+        Allele("mdh", "11", None),
+        Allele("pgi", "125", None),
+        Allele("recA", "89", None)
+    ), "478", "unknown")
 
-hinfluenzae_fdaargos_bad_profile = MLSTProfile((
+hinfluenzae_2014_102_bad_profile = MLSTProfile((
         Allele("adk", "3", None),
         Allele("atpG", "121", None),
         Allele("frdB", "6", None),
@@ -68,15 +68,12 @@ hinfluenzae_fdaargos_bad_profile = MLSTProfile((
         Allele("mdh", "12", None),
         Allele("pgi", "4", None),
         Allele("recA", "5", None)
-    ), "3", "ST-3 complex")
+    ), "unknown", "unknown")
 
-hinfluenzae_fdaargos_sequence = str(SeqIO.read("tests/resources/fdaargos_1560_hinfluenza.fasta", "fasta").seq)
-
-hinfluenzae_fdaargos_fragmented_sequence = tuple(SeqIO.parse("tests/resources/tohama_I_bpertussis_features.fasta", "fasta"))
 
 @pytest.mark.parametrize("local_db,database_api,database_name,schema_id,seq_path,feature_seqs_path,expected_profile,bad_profile", [
     (False, "https://bigsdb.pasteur.fr/api", "pubmlst_bordetella_seqdef", 3, "tohama_I_bpertussis.fasta", "tohama_I_bpertussis_features.fasta", bpertussis_tohamaI_profile, bpertussis_tohamaI_bad_profile),
-    (False, "https://rest.pubmlst.org", "pubmlst_hinfluenzae_seqdef", 1, "fdaargos_1560_hinfluenza.fasta", "fdaargos_1560_hinfluenza_features.fasta", hinfluenzae_fdaargos_profile, hinfluenzae_fdaargos_bad_profile),
+    (False, "https://rest.pubmlst.org", "pubmlst_hinfluenzae_seqdef", 1, "2014-102_hinfluenza.fasta", "2014-102_hinfluenza_features.fasta", hinfluenzae_2014_102_profile, hinfluenzae_2014_102_bad_profile),
 ])
 class TestBIGSdbMLSTProfiler:
     async def test_profiling_results_in_exact_matches_when_exact(self, local_db, database_api, database_name, schema_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
@@ -202,7 +199,6 @@ class TestBIGSdbIndex:
             assert databases["pubmlst_bordetella_seqdef"] == "https://bigsdb.pasteur.fr/api"
 
     @pytest.mark.parametrize("local", [
-        (True),
         (False)
     ])
     async def test_bigsdb_index_instantiates_correct_profiler(self, local):

tests/autobigs/engine/test_reading.py

@@ -2,6 +2,6 @@ from autobigs.engine.reading import read_fasta
 
 
 async def test_fasta_reader_not_none():
-    named_strings = read_fasta("tests/resources/tohama_I_bpertussis.fasta")
-    async for named_string in named_strings:
+    named_strings = await read_fasta("tests/resources/tohama_I_bpertussis.fasta")
+    for named_string in named_strings:
         assert named_string.name == "BX470248.1"

tests/autobigs/engine/test_writing.py

@@ -0,0 +1,47 @@
+from typing import AsyncIterable, Iterable
+
+import pytest
+from autobigs.engine.structures.alignment import AlignmentStats
+from autobigs.engine.writing import alleles_to_text_map, write_mlst_profiles_as_csv
+from autobigs.engine.structures.mlst import Allele, MLSTProfile
+import tempfile
+from csv import reader
+from os import path
+
+
+@pytest.fixture
+def dummy_alphabet_mlst_profile():
+    return MLSTProfile((
+        Allele("A", "1", None),
+        Allele("D", "1", None),
+        Allele("B", "1", None),
+        Allele("C", "1", None),
+        Allele("C", "2", AlignmentStats(90, 10, 0, 90))
+    ), "mysterious", "very mysterious")
+
+async def iterable_to_asynciterable(iterable: Iterable):
+    for iterated in iterable:
+        yield iterated
+
+async def test_column_order_is_same_as_expected_file(dummy_alphabet_mlst_profile: MLSTProfile):
+    dummy_profiles = [("test_1", dummy_alphabet_mlst_profile)]
+    with tempfile.TemporaryDirectory() as temp_dir:
+        output_path = path.join(temp_dir, "out.csv")
+        await write_mlst_profiles_as_csv(iterable_to_asynciterable(dummy_profiles), output_path)
+        with open(output_path) as csv_handle:
+            csv_reader = reader(csv_handle)
+            lines = list(csv_reader)
+            target_columns = lines[4:]
+            assert target_columns == sorted(target_columns)
+
+async def test_alleles_to_text_map_mapping_is_correct(dummy_alphabet_mlst_profile: MLSTProfile):
+    mapping = alleles_to_text_map(dummy_alphabet_mlst_profile.alleles)
+    expected_mapping = {
+        "A": "1",
+        "B": "1",
+        "C": ("1", "2*"),
+        "D": "1"
+    }
+    for allele_name, allele_ids in mapping.items():
+        assert allele_name in expected_mapping
+        assert allele_ids == expected_mapping[allele_name]

tests/resources/fdaargos_1560_hinfluenza_adk.fasta

@@ -1,11 +0,0 @@
->lcl|CP085952.1_gene_371 [gene=adk] [locus_tag=LK401_01855] [location=complement(365128..365772)] [gbkey=Gene]
-ATGAAAATTATTCTTTTAGGTGCACCGGGTGCAGGTAAAGGCACTCAAGCACAATTTATTATGAACAAAT
-TTGGTATCCCGCAAATTTCAACTGGTGATATGTTCCGTGCTGCAATCAAAGCGGGGACTGAACTTGGCAA
-ACAAGCTAAAGCATTAATGGATGAAGGTAAATTAGTGCCAGATGAATTAACCGTTGCCCTTGTAAAAGAT
-CGTATTGCTCAAGCTGACTGCACAAATGGTTTCTTGTTAGATGGTTTCCCTCGTACTATTCCACAAGCGG
-ATGCACTGAAAGATTCAGGTGTTAAAATTGACTTTGTTTTAGAATTTGATGTGCCAGACGAAGTGATTGT
-TGAACGTATGAGTGGCCGTCGCGTACACCAAGCGTCTGGCCGTTCTTACCACATCGTTTATAATCCACCA
-AAAGTGGAAGGTAAAGATGATGTAACAGGCGAAGATTTAATTATTCGTGCAGACGATAAACCAGAAACTG
-TATTAGATCGTTTAGCCGTATATCATAAACAAACTAGCCCATTAATTGATTATTACCAAGCAGAAGCGAA
-AGCGGGGAATACTCAATATTTCCGTTTAGACGGTACACAAAAAGTAGAAGAAGTTAGCCAAGAGTTAGAT
-AAAATCTTAGGCTAA