Updated local repository publishing requirement for CI

Added additional error messages to help user with usage.

.devcontainer/Dockerfile

@@ -0,0 +1,16 @@
+FROM mcr.microsoft.com/devcontainers/miniconda:1-3
+
+# Copy environment.yml (if found) to a temp location so we update the environment. Also
+# copy "noop.txt" so the COPY instruction does not fail if no environment.yml exists.
+COPY environment.yml* .devcontainer/noop.txt /tmp/conda-tmp/
+RUN if [ -f "/tmp/conda-tmp/environment.yml" ]; then umask 0002 && /opt/conda/bin/conda env update -n base -f /tmp/conda-tmp/environment.yml; fi \
+    && rm -rf /tmp/conda-tmp
+
+# [Optional] Uncomment to install a different version of Python than the default
+# RUN conda install -y python=3.6 \
+#     && pip install --no-cache-dir pipx \
+#     && pipx reinstall-all
+
+# [Optional] Uncomment this section to install additional OS packages.
+# RUN apt-get update && export DEBIAN_FRONTEND=noninteractive \
+#     && apt-get -y install --no-install-recommends <your-package-list-here>

.devcontainer/devcontainer.json

@@ -1,9 +1,11 @@
 // For format details, see https://aka.ms/devcontainer.json. For config options, see the
-// README at: https://github.com/devcontainers/templates/tree/main/src/python
+// README at: https://github.com/devcontainers/templates/tree/main/src/miniconda
 {
-	"name": "Python 3",
-	// Or use a Dockerfile or Docker Compose file. More info: https://containers.dev/guide/dockerfile
-	"image": "mcr.microsoft.com/devcontainers/python:1-3.12-bullseye",
+	"name": "Miniconda (Python 3)",
+	"build": { 
+		"context": "..",
+		"dockerfile": "Dockerfile"
+	},
 
 	// Features to add to the dev container. More info: https://containers.dev/features.
 	// "features": {},
@@ -12,7 +14,9 @@
 	// "forwardPorts": [],
 
 	// Use 'postCreateCommand' to run commands after the container is created.
-	"postCreateCommand": "pip3 install --user -r requirements.txt && pip install -e .",
+	"postCreateCommand": "pip install -e .",
+
+	// Configure tool-specific properties.
 	"customizations": {
 		"vscode": {
 			"extensions": [
@@ -20,8 +24,6 @@
 			]
 		}
 	},
-	// Configure tool-specific properties.
-	// "customizations": {},
 
 	// Uncomment to connect as root instead. More info: https://aka.ms/dev-containers-non-root.
 	// "remoteUser": "root"

.devcontainer/noop.txt

@@ -0,0 +1,3 @@
+This file is copied into the container along with environment.yml* from the
+parent folder. This is done to prevent the Dockerfile COPY instruction from 
+failing if no environment.yml is found.

.vscode/extensions.json

@@ -0,0 +1,5 @@
+{
+    "recommendations": [
+        "mechatroner.rainbow-csv"
+    ]
+}

.vscode/launch.json

@@ -0,0 +1,24 @@
+{
+    // Use IntelliSense to learn about possible attributes.
+    // Hover to view descriptions of existing attributes.
+    // For more information, visit: https://go.microsoft.com/fwlink/?linkid=830387
+    "version": "0.2.0",
+    "configurations": [
+        
+        {
+            "name": "Program",
+            "type": "debugpy",
+            "request": "launch",
+            "program": "${workspaceFolder}/src/autobigs/cli/program.py",
+            "console": "integratedTerminal",
+            "args": [
+                "st",
+                "-sn",
+                "MLST",
+                "tests/resources/tohama_I_bpertussis.fasta,tests/resources/tohama_I_bpertussis_features.fasta",
+                "pubmlst_bordetella_seqdef",
+                "out.csv"
+            ]
+        }
+    ]
+}

Jenkinsfile

@@ -2,14 +2,16 @@ pipeline {
     agent {
         kubernetes {
             cloud 'rsys-devel'
-            defaultContainer 'pip'
-            inheritFrom 'pip'
+            defaultContainer 'miniforge3'
+            inheritFrom 'miniforge'
         }
     }
     stages {
         stage("install") {
             steps {
-                sh 'python -m pip install -r requirements.txt'
+                sh 'conda config --add channels bioconda'
+                sh 'conda config --add channels https://git.reslate.systems/api/packages/ydeng/conda'
+                sh 'conda env update -n base -f environment.yml'
             }
         }
         stage("unit tests") {
@@ -22,26 +24,28 @@ pipeline {
         stage("build") {
             steps {
                 sh "python -m build"
+                sh "grayskull pypi dist/*.tar.gz --maintainers 'Harrison Deng'"
+                sh "python scripts/patch_recipe.py"
+                sh 'conda build autobigs-cli -c bioconda --output-folder conda-bld --verify'
             }
         }
         stage("archive") {
             steps {
-                archiveArtifacts artifacts: 'dist/*.tar.gz, dist/*.whl', fingerprint: true, followSymlinks: false, onlyIfSuccessful: true
+                archiveArtifacts artifacts: 'dist/*.tar.gz, dist/*.whl, conda-bld/**/*.conda', fingerprint: true, followSymlinks: false, onlyIfSuccessful: true
             }
         }
         stage("publish") {
             parallel {
                 stage ("git.reslate.systems") {
                     when {
-                        not {
-                            tag '*.*.*'
-                        }
+                        branch '**/main'
                     }
                     environment {
                         CREDS = credentials('username-password-rs-git')
                     }
                     steps {
                         sh script: 'python -m twine upload --repository-url https://git.reslate.systems/api/packages/ydeng/pypi -u ${CREDS_USR} -p ${CREDS_PSW} --non-interactive --disable-progress-bar --verbose dist/*'
+                        sh 'curl --user ${CREDS_USR}:${CREDS_PSW} --upload-file conda-bld/**/*.conda https://git.reslate.systems/api/packages/${CREDS_USR}/conda/$(basename conda-bld/**/*.conda)'
                     }
                 }
                 stage ("pypi.org") {

README.md

@@ -9,7 +9,7 @@ This program is simply a command-line interface for [autoBIGS.engine](https://py
 This CLI is capable of exactly what [autoBIGS.engine](https://pypi.org/project/autoBIGS.engine) is capable of:
 - Import multiple whole genome FASTA files
 - Fetch the available BIGSdb databases that is currently live and available
-- Fetch the available BIGSdb database schemas for a given MLST database
+- Fetch the available BIGSdb database schemes for a given MLST database
 - Retrieve exact/non-exact MLST allele variant IDs based off a sequence
 - Retrieve MLST sequence type IDs based off a sequence
 - Inexact matches are annotated with an asterisk (\*)
@@ -17,7 +17,7 @@ This CLI is capable of exactly what [autoBIGS.engine](https://pypi.org/project/a
 
 ## Planned Features for CLI
 - Specifications of multi-threading capacity
-- Session authentication for updated database schemas (as required by both PubMLST and Institut Pasteur)
+- Session authentication for updated database schemes (as required by both PubMLST and Institut Pasteur)
 
 Please refer to [autoBIGS.engine](https://pypi.org/project/autoBIGS.engine) for more planned features.
 
@@ -33,15 +33,15 @@ This CLI can be installed with `pip`. Please ensure [pip is installed](https://p
 
 ### Example
 
-Let's say you have a fasta called `seq.fasta` which contains several sequences. You know all sequences in `seq.fasta` are Bordetella pertussis sequences, and you know you have the sequences for the necessary targets of your schema in each of them. You want to retrieve MLST profiles for all of them. This can be done by:
+Let's say you have a fasta called `seq.fasta` which contains several sequences. You know all sequences in `seq.fasta` are Bordetella pertussis sequences, and you know you have the sequences for the necessary targets of your scheme in each of them. You want to retrieve MLST profiles for all of them. This can be done by:
 
-1. Running `autobigs info -l` to list all available `seqdef` databases and find the database associated with Bordetella (you should see one called `pubmlst_bordetella_seqdef`).
+1. Running `autoBIGS info -l` to list all available `seqdef` databases and find the database associated with Bordetella (you should see one called `pubmlst_bordetella_seqdef`).
 
-2. Then, run `autobigs info -lschema pubmlst_bordetella_seqdef` to get the available typing schemas and their associated IDs. In this example, let's assume we want a normal MLST scheme. In this case, we would pay attention to the number next to `MLST` (it should be `3`).
+2. Then, run `autoBIGS info -lschemes pubmlst_bordetella_seqdef` to get the available typing schemes and their associated IDs. In this example, let's assume we want a normal MLST scheme. In this case, we would pay attention to the number next to `MLST` (it should be `3`). Alternatively, we can look at the name of the schemes and use those too (in this case, it is simply `MLST`).
 
-3. Then, run `autobigs st -h` and familiarize yourself with the parameters needed for sequence typing.
+3. Then, run `autoBIGS st -h` and familiarize yourself with the parameters needed for sequence typing.
 
-4. Namely, you should find that you will need to run `autobigs st seq.fasta pubmlst_bordetella_seqdef 3 output.csv`. You can optionally include multiple `FASTA` files, and `--stop-on-fail` to stop typing if one of your sequences fail to retrieve any type. 
+4. Namely, you should find that you will need to run `autoBIGS st seq.fasta pubmlst_bordetella_seqdef -sid 3 output.csv` (alternatively, `-sid 3` may be replaced with `-sn MLST`). You can optionally include multiple `FASTA` files, and `--stop-on-fail` to stop typing if one of your sequences fail to retrieve any type. 
 
 5. Sit tight, and wait. The `output.csv` will contain your results once completed.
 

environment.yml

@@ -0,0 +1,14 @@
+name: base
+channels:
+  - bioconda
+  - conda-forge
+dependencies:
+  - pytest
+  - pytest-asyncio
+  - pytest-cov
+  - python-build
+  - conda-build
+  - twine==6.0.1
+  - setuptools_scm
+  - grayskull
+  - curl

pyproject.toml

@@ -8,7 +8,7 @@ dynamic = ["version"]
 readme = "README.md"
 license = {text = "GPL-3.0-or-later"}
 dependencies = [
-    "autoBIGS-engine==0.12.*"
+    "autoBIGS-engine==0.14.*"
 ]
 requires-python = ">=3.12"
 description = "A CLI tool to rapidly fetch fetch MLST profiles given sequences for various diseases."

scripts/patch_recipe.py

@@ -0,0 +1,103 @@
+#!/usr/bin/env python3
+
+import argparse
+from os import fdopen, path
+import os
+import re
+import shutil
+from sys import argv
+import tempfile
+
+INDENTATION = "  "
+GRAYSKULL_OUTPUT_PATH = "autoBIGS.cli"
+RUN_EXPORTED_VALUE = r'{{ pin_subpackage( name|lower|replace(".", "-"), max_pin="x.x") }}'
+LICENSE_SUFFIX = "-or-later"
+HOME_PAGE = "https://github.com/Syph-and-VPD-Lab/autoBIGS.cli"
+
+def _calc_indentation(line: str):
+    return len(re.findall(INDENTATION, line.split(line.strip())[0])) if line != "\n" else 0
+
+def read_grayskull_output():
+    original_recipe = path.abspath(GRAYSKULL_OUTPUT_PATH)
+    original_meta = path.join(original_recipe, "meta.yaml")
+    meta_file = open(original_meta)
+    lines = meta_file.readlines()
+    meta_file.close()
+    return lines
+
+def update_naming_scheme(lines):
+    modified_lines = []
+    for line in lines:
+        matches = re.finditer(r"\{\{\s*name\|lower()\s+\}\}", line)
+        modified_line = line
+        for match in matches:
+            modified_line = modified_line[:match.start(1)] + r'|replace(".", "-")' + modified_line[match.end(1):]
+        modified_lines.append(modified_line)
+    return modified_lines
+
+def inject_run_exports(lines: list[str]):
+    package_indent = False
+    modified_lines = []
+    for line in lines:
+        indentation_count = _calc_indentation(line)
+        if line == "build:\n" and indentation_count == 0:
+            package_indent = True
+            modified_lines.append(line)
+        elif package_indent and indentation_count == 0:
+            modified_lines.append(INDENTATION*1 + "run_exports:\n")
+            modified_lines.append(INDENTATION*2 + "- " + RUN_EXPORTED_VALUE + "\n")
+            package_indent = False
+        else:
+            modified_lines.append(line)
+    return modified_lines
+
+def suffix_license(lines: list[str]):
+    about_indent = False
+    modified_lines = []
+    for line in lines:
+        indentation_count = _calc_indentation(line)
+        if line == "about:\n" and indentation_count == 0:
+            about_indent = True
+            modified_lines.append(line)
+        elif about_indent and indentation_count == 1 and line.lstrip().startswith("license:"):
+            modified_lines.append(line.rstrip() + LICENSE_SUFFIX  + "\n")
+            about_indent = False
+        else:
+            modified_lines.append(line)
+    return modified_lines
+
+def inject_home_page(lines: list[str]):
+    about_indent = False
+    modified_lines = []
+    for line in lines:
+        indentation_count = _calc_indentation(line)
+        if line == "about:\n" and indentation_count == 0:
+            about_indent = True
+            modified_lines.append(line)
+        elif about_indent and indentation_count == 0:
+            modified_lines.append(INDENTATION + "home: " + HOME_PAGE + "\n")
+            about_indent = False
+        else:
+            modified_lines.append(line)
+    return modified_lines
+
+def write_to_original(lines: list[str]):
+    original_recipe = path.abspath(GRAYSKULL_OUTPUT_PATH)
+    original_meta = path.join(original_recipe, "meta.yaml")
+    with open(original_meta, "w") as file:
+        file.writelines(lines)
+
+def rename_recipe_dir():
+    new_recipe_name = path.abspath(path.join(GRAYSKULL_OUTPUT_PATH.replace(".", "-").lower()))
+    shutil.rmtree(new_recipe_name, ignore_errors=True)
+    os.replace(path.abspath(GRAYSKULL_OUTPUT_PATH), new_recipe_name)
+
+if __name__ == "__main__":
+    original_grayskull_out = read_grayskull_output()
+    modified_recipe_meta = None
+    modified_recipe_meta = update_naming_scheme(original_grayskull_out)
+    modified_recipe_meta = inject_run_exports(modified_recipe_meta)
+    modified_recipe_meta = suffix_license(modified_recipe_meta)
+    modified_recipe_meta = inject_home_page(modified_recipe_meta)
+    write_to_original(modified_recipe_meta)
+    rename_recipe_dir()

src/autobigs/cli/info.py

@@ -6,7 +6,9 @@ from autobigs.engine.analysis.bigsdb import BIGSdbIndex
 
 def setup_parser(parser: ArgumentParser):
     parser.description = "Fetches the latest BIGSdb MLST database definitions."
-    parser.add_argument(
+    
+    retrieve_group = parser.add_mutually_exclusive_group(required=True)
+    retrieve_group.add_argument(
         "--retrieve-bigsdbs", "-l",
         action="store_true",
         dest="list_dbs",
@@ -15,15 +17,15 @@ def setup_parser(parser: ArgumentParser):
         help="Lists all known BIGSdb MLST databases (fetched from known APIs and cached)."
     )
 
-    parser.add_argument(
-        "--retrieve-bigsdb-schemas", "-lschemas",
+    retrieve_group.add_argument(
+        "--retrieve-bigsdb-schemes", "-lschemes",
         nargs="+",
         action="extend",
-        dest="list_bigsdb_schemas",
+        dest="list_bigsdb_schemes",
         required=False,
         default=[],
         type=str,
-        help="Lists the known schema IDs for a given BIGSdb sequence definition database name. The name, and then the ID of the schema is given."
+        help="Lists the known scheme IDs for a given BIGSdb sequence definition database name. The name, and then the ID of the scheme is given."
     )
 
     parser.add_argument(
@@ -39,10 +41,6 @@ def setup_parser(parser: ArgumentParser):
 
 async def run(args: Namespace):
     async with BIGSdbIndex() as bigsdb_index:
-        if args.list_dbs and len(args.list_bigsdb_schemas) > 0:
-            print("Cannot specify both database listing and schema listing, please choose one!")
-            exit(1)
-
         if args.list_dbs:
             known_seqdef_dbs = await bigsdb_index.get_known_seqdef_dbs(force=False)
             sorted_seqdef_dbs = [(name, source) for name, source in sorted(known_seqdef_dbs.items())]
@@ -55,21 +53,19 @@ async def run(args: Namespace):
                     writer.writerows(sorted_seqdef_dbs)
                     print("\nDatabase output written to {0}".format(args.csv_output))
 
-        for bigsdb_schema_name in args.list_bigsdb_schemas:
-            schemas = await bigsdb_index.get_schemas_for_seqdefdb(bigsdb_schema_name)
-            sorted_schemas = [(name, id) for name, id in sorted(schemas.items())]
-            print("The following are the known schemas for \"{0}\", and their associated IDs:".format(bigsdb_schema_name))
-            print("\n".join(["{0}: {1}".format(name, id) for name, id in sorted_schemas]))
+        if args.list_bigsdb_schemes:
+            csv_scheme_rows = []
+            for bigsdb_scheme_name in args.list_bigsdb_schemes:
+                schemes = await bigsdb_index.get_schemes_for_seqdefdb(bigsdb_scheme_name)
+                csv_scheme_rows.extend([(name, id, bigsdb_scheme_name) for name, id in sorted(schemes.items())])
+                print("The following are the known schemes for \"{0}\", and their associated IDs:".format(bigsdb_scheme_name))
+                print("\n".join(["{0}: {1}".format(name, id) for name, id, database in csv_scheme_rows]))
             if args.csv_output:
                 with open(args.csv_output, "w") as csv_out_handle:
                     writer = csv.writer(csv_out_handle)
-                    writer.writerow(("Name", "ID"))
-                    writer.writerows(sorted_schemas)
-                    print("\nSchema list output written to {0}".format(args.csv_output))
-
-        if not (args.list_dbs or len(args.list_bigsdb_schemas) > 0):
-            print("Nothing to do. Try specifying \"-l\" for a list of known databases, or \"-h\" for more information.")
-            exit(1)
+                    writer.writerow(("Name", "ID", "Database Name"))
+                    writer.writerows(csv_scheme_rows)
+                print("\nscheme list output written to {0}".format(args.csv_output))
 
 def run_asynchronously(args: Namespace):
     asyncio.run(run(args))

src/autobigs/cli/program.py

@@ -7,7 +7,7 @@ from autobigs.cli import info, st
 from autobigs.cli.meta import get_module_base_name
 import importlib
 
-root_parser = argparse.ArgumentParser(epilog='Use "%(prog)s info -h" to learn how to get available MLST databases, and their available schemas.'
+root_parser = argparse.ArgumentParser(epilog='Use "%(prog)s info -h" to learn how to get available MLST databases, and their available schemes.'
                                       + ' Once that is done, use "%(prog)s st -h" to learn how to retrieve MLST profiles.'
                                       )
 subparsers = root_parser.add_subparsers(required=False)
@@ -20,17 +20,17 @@ root_parser.add_argument(
     action="store_true",
     default=False,
     required=False,
-    help="Displays the autoBIGS.CLI version, and the autoBIGS.Engine version."
+    help="Displays the autoBIGS.cli version, and the autoBIGS.Engine version."
 )
 
 
 def run():
     args = root_parser.parse_args()
     if args.version:
-        print(f'autoBIGS.CLI is running version {
-              metadata.version("autoBIGS-cli")}.')
-        print(f'autoBIGS.Engine is running version {
-              metadata.version("autoBIGS-engine")}.')
+        print(f'autoBIGS.cli is running version {
+              metadata.version("autobigs-cli")}.')
+        print(f'autoBIGS.engine is running version {
+              metadata.version("autobigs-engine")}.')
     if hasattr(args, "run"):
         args.run(args)
     elif not args.version:

src/autobigs/cli/st.py

@@ -4,8 +4,7 @@ import asyncio
 import datetime
 from autobigs.engine.writing import write_mlst_profiles_as_csv
 from autobigs.engine.reading import read_multiple_fastas
-from autobigs.engine.analysis.bigsdb import BIGSdbIndex
-
+from autobigs.engine.analysis.bigsdb import BIGSdbIndex, BIGSdbMLSTProfiler
 
 def setup_parser(parser: ArgumentParser):
     parser.description = "Returns MLST exact profile matches."
@@ -23,10 +22,18 @@ def setup_parser(parser: ArgumentParser):
         help="The BIGSdb seqdef database to use for typing."
     )
 
-    parser.add_argument(
-        "schema",
+    scheme_group = parser.add_mutually_exclusive_group()
+
+    scheme_group.add_argument(
+        "--scheme-id", "-sid",
         type=int,
-        help="The BIGSdb seqdef database schema ID (integer) to use for typing."
+        help="The BIGSdb seqdef database scheme ID (integer) to use for typing."
+    )
+
+    scheme_group.add_argument(
+        "--scheme-name", "-sn",
+        type=str,
+        help="The BIGSdb seqdef database scheme name (string) to use for typing. If neither this argument, nor the ID equivalent is defined, a scheme ID with name \"MLST\" will be used."
     )
 
     parser.add_argument(
@@ -48,13 +55,34 @@ def setup_parser(parser: ArgumentParser):
 
 async def run(args: Namespace):
     async with BIGSdbIndex() as bigsdb_index:
-        gen_strings = read_multiple_fastas(args.fastas)
-        async with await bigsdb_index.build_profiler_from_seqdefdb(False, args.seqdefdb, args.schema) as mlst_profiler:
+        fastas = list()
+        for fasta_str in args.fastas:
+            fastas.extend(fasta_str.split(','))
+
+        gen_strings = read_multiple_fastas(fastas)
+        scheme_id_lookup = await bigsdb_index.get_schemes_for_seqdefdb(args.seqdefdb)
+        scheme_name_lookup = {value: key for key, value in scheme_id_lookup.items()}
+        known_dbs = await bigsdb_index.get_known_seqdef_dbs()
+
+        if args.seqdefdb not in known_dbs:
+            raise ValueError("\"{0}\" is a known database. See -h for help.")
+        if args.scheme_id and args.scheme_id not in scheme_id_lookup.values():
+            raise ValueError("ID {0} not a known database scheme ID for database \"{1}\". See -h for help.".format(args.scheme_id, args.seqdefdb))
+        if args.scheme_name and args.scheme_name not in scheme_id_lookup:
+            raise ValueError("\"{0}\" not a known database scheme name for database \"{1}\". See -h for help.".format(args.scheme_name, args.seqdefdb))
+        if not (args.scheme_name or args.scheme_id) and "MLST" not in scheme_id_lookup:
+            raise ValueError("\"MLST\" not a known database scheme name for database \"{0}\". See -h for help.".format(args.seqdefdb))
+
+        selected_scheme_id = args.scheme_id or (scheme_id_lookup[args.scheme_name] if args.scheme_name else None) or scheme_id_lookup["MLST"]
+
+        async with await bigsdb_index.build_profiler_from_seqdefdb(False, args.seqdefdb, selected_scheme_id) as mlst_profiler:
+            if not isinstance(mlst_profiler, BIGSdbMLSTProfiler):
+                raise TypeError("MLST profiler type invalid")
             mlst_profiles = mlst_profiler.profile_multiple_strings(gen_strings, args.stop_on_fail)
-            failed = await write_mlst_profiles_as_csv(mlst_profiles, args.out)
+            failed = await write_mlst_profiles_as_csv(mlst_profiles, args.out, await bigsdb_index.get_scheme_loci(args.seqdefdb, selected_scheme_id))
             if len(failed) > 0:
                 print(f"A total of {len(failed)} IDs failed (no profile found):\n{"\n".join(failed)}")
-            print(f"Completed fetching MLSTs for {len(args.fastas)} sequences.")
+            print(f"Completed fetching from {args.seqdefdb} for {scheme_name_lookup[selected_scheme_id]}s for {len(fastas)} sequences.")
 
 def run_asynchronously(args):
     asyncio.run(run(args))

tests/resources/tohama_I_bpertussis_minimized_features.fasta

@@ -0,0 +1,133 @@
+>lcl|BX640419.1_cds_CAE43044.1_2724 [gene=adK] [locus_tag=BP2769] [db_xref=GOA:P0DKX8,InterPro:IPR000850,InterPro:IPR006259,InterPro:IPR007862,InterPro:IPR027417] [protein=adenylate kinase] [protein_id=CAE43044.1] [location=164032..164688] [gbkey=CDS]
+ATGCGTCTCATTCTGCTCGGACCGCCCGGAGCCGGCAAAGGCACCCAAGCCGCCTTTCTCACCCAACACT
+ACGGCATCCCGCAGATATCCACCGGTGACATGCTGCGCGCCGCCGTCAAGGCCGGCACGCCGCTGGGCCT
+GGAAGCCAAGAAGGTCATGGACGCGGGCGGCCTGGTCTCGGACGACCTGATCATCGGCCTGGTGCGCGAT
+CGCCTGACCCAGCCCGATTGCGCCAACGGCTACCTGTTCGACGGTTTCCCGCGCACCATCCCGCAGGCCG
+ACGCGCTCAAGAGCGCCGGCATCGCGCTGGATTACGTGGTCGAGATCGAAGTGCCGGAAAGCGACATCAT
+CGAACGCATGAGCGAACGCCGCGTGCACCCGGCCAGCGGCCGCAGCTACCACGTACGCTTCAATCCGCCC
+AAGGCCGAAGGCGTGGACGACGTCACGGGCGAACCGCTGGTGCAGCGCGACGACGACCGCGAGGAAACCG
+TGCGCCATCGTCTCAACGTCTACCAGAACCAGACCCGCCCGCTGGTCGACTACTACTCGTCCTGGGCCCA
+GTCCGATGCCGCCGCGGCGCCCAAGTACCGCAAGATCTCCGGCGTCGGCTCGGTCGACGAAATCAAGAGC
+CGCCTGTCGCAGGCTCTGCAGAGCTAA
+>lcl|BX640411.1_cds_CAE40628.1_248 [gene=fumC] [locus_tag=BP0248] [db_xref=GOA:Q7W0A2,InterPro:IPR000362,InterPro:IPR005677,InterPro:IPR008948,InterPro:IPR018951,InterPro:IPR020557,InterPro:IPR022761,InterPro:IPR024083] [protein=fumarate hydratase class II] [protein_id=CAE40628.1] [location=256543..257934] [gbkey=CDS]
+ATGAAAACCCGCACCGAAAAAGACACTTTCGGCCCGATCGAGGTGCCCGAGCAGCACCTGTGGGGCGCGC
+AGACCCAGCGCTCGCTGCATTTCTTCGCGATCTCGACCGAGAAGATGCCGGTGCCGCTGGTCGCCGCCAT
+GGCACGCCTGAAGCGCGCCGCCGCCAAGGTCAACGCCGAGCTGGGCGAGCTGGATCCGCAGGTCGCAGAC
+GCCATCATGCGGGCCGCCGATGAGGTGATCGCCGGCAAGTGGCCCGACGAGTTTCCGCTGTCGGTCTGGC
+AGACCGGCTCGGGCACGCAGAGCAACATGAACATGAACGAGGTGCTGGCCAACCGCGCCTCCGAGCTGCT
+GGGCGGCGAGCGCGGCGAAGGCCGCAAGGTGCACCCCAACGACCACGTGAACCGGGGCCAGTCGTCCAAC
+GATACCTTTCCGACCGCCATGCACGTGGCCGCCGCGGTCGAGGTCGAGCACCGCGTGCTGCCCGCCCTGA
+AGGCGTTGCGCGGCACGCTGGCCGCCAAGAGCGCGGCGTTCTACGACATCGTCAAGATCGGTCGCACCCA
+TTTGCAGGACGCCACCCCGTTGACGCTGGGCCAGGAGATCTCCGGCTACGTGGCGCAGCTGGACCTGGCC
+GAGCAGCAGATCCGCGCGACGCTGGCCGGCCTGCACCAGCTGGCCATCGGCGGCACGGCGGTGGGCACCG
+GCCTGAACGCGCATCCGCAGTTCAGCGCCAAGGTATCGGCCGAACTGGCCCATGACACGGGCAGCGCGTT
+CGTGTCGGCGCCCAACAAGTTCCAGGCGCTGGCTTCGCACGAGGCGCTGCTGTTCGCGCACGGCGCCTTG
+AAGACGCTGGCCGCCGGCCTGATGAAGATCGCCAACGATGTGCGCTGGCTGGCCAGCGGCCCGCGCTCGG
+GGCTGGGCGAAATCAGCATTCCCGAGAACGAGCCGGGCAGCTCCATCATGCCGGGCAAGGTCAACCCGAC
+CCAGTGCGAAGCCGTCACGATGCTGGCCGCGCAGGTCATGGGCAACGACGTGGCCATCAATGTCGGCGGG
+GCCAGCGGCAACTTCGAGCTGAACGTCTTCAAGCCGCTGGTGATCCACAATTTCCTGCAGTCGGTGCGCC
+TGCTGGCCGACGGCATGGTCAGCTTCGACAAGCACTGCGCGGCCGGCATCGAGCCCAACCGCGAGCGCAT
+CACCGAGCTGGTCGAGCGTTCGCTGATGCTGGTGACTGCGCTCAACCCGCACATCGGCTACGACAAGGCC
+GCGCAGATCGCCAAGAAGGCGCACAAGGAAAACCTGTCGCTGAAAGAGGCGGCGCTGGCGCTGGGGCACC
+TGACCGAGGCGCAGTTCGCCGAGTGGGTGGTGCCGGGCGACATGACCAACGCGCGCCGCTAG
+>lcl|BX640420.1_cds_CAE43224.1_2904 [gene=glyA] [locus_tag=BP2952] [db_xref=GOA:Q7VUW7,InterPro:IPR001085,InterPro:IPR015421,InterPro:IPR015422,InterPro:IPR015424,InterPro:IPR019798] [protein=serine hydroxymethyltransferase] [protein_id=CAE43224.1] [location=complement(8611..9858)] [gbkey=CDS]
+ATGTTCAACCGCAACCTGACCCTCGACCAGGTGGATCCCGACGTCTGGGCCGCCATCCAGAAAGAAGACG
+TACGCCAGGAACAGCACATCGAGCTGATCGCGTCCGAGAACTACGCCAGCCCCGCCGTGATGCAGGCCCA
+GGGCACGCAACTGACCAACAAGTATGCGGAAGGCTACCCGGGCAAGCGCTACTACGGCGGTTGCGAGTAC
+GTCGACGTGGTCGAGCAGCTGGCCATCGACCGCCTGAAGCAGATTTTCGGCGCCGAGGCCGCCAACGTGC
+AGCCGAACTCCGGCTCGCAGGCCAACCAGGGCGTGTACATGGCGGTGCTCAAGCCGGGCGATACCGTGCT
+GGGCATGAGCCTGGCCGAAGGCGGTCACCTGACGCACGGCGCGTCGGTCAACGCCTCGGGCAAGCTGTAC
+AACTTCGTGCCCTACGGCCTGGACGCCGACGAGGTGCTGGACTACGCCCAGGTCGAGCGGCTGACCAAGG
+AACACAAGCCCAAGCTGATCGTGGCCGGCGCCTCCGCGTACGCGCTGCACATCGACTTCGAGCGCATGGC
+GCGCATCGCCCACGACAACGGCGCGCTGTTCATGGTGGACATCGCCCACTATGCCGGCCTGGTGGCCGGC
+GGCGCCTATCCCAACCCGGTGCCGCACGCCGATTTCGTCACCTCCACCACGCACAAGTCGCTGCGCGGCC
+CGCGCGGCGGCGTCATCATGATGAAGGCCGAGTTCGAGAAGGCCGTCAATTCGGCCATCTTCCCGGGCAT
+CCAGGGCGGTCCGCTGATGCACGTCATCGCGGCCAAGGCCGTGGCCTTCAAGGAAGCGCTGTCGCCCGAG
+TTCCAGGATTACGCCCAGCAGGTCGTCAAGAACGCCAAGGTGCTGGCCGATACGCTGGTCAAGCGCGGCC
+TGCGCATCGTGTCGGGCAGGACCGAAAGCCACGTCATGCTGGTGGACCTGCGTCCCAAGGGCATTACCGG
+CAAGGAAGCGGAAGCGGTGCTGGGCCAGGCCCACATCACGGTCAACAAGAACGCCATTCCCAACGACCCG
+GAAAAGCCCTTCGTGACCAGCGGCATCCGCCTGGGCACTCCGGCCATGACCACCCGCGGCTTCAAGGAGG
+CCGAGGCCGAGCTGACCGCCAACCTGATCGCCGACGTGCTGGACAATCCGCGCGACGAGGCGAACATCGC
+CGCGGTGCGCGCGCGGGTCAATGAACTGACCGCCCGCCTGCCCGTCTACGGCAACTGA
+>lcl|BX640418.1_cds_CAE42760.1_2440 [gene=icd] [locus_tag=BP2488] [db_xref=GOA:Q7VVZ2,InterPro:IPR001804,InterPro:IPR004439,InterPro:IPR019818,InterPro:IPR024084,UniProtKB/TrEMBL:Q7VVZ2] [protein=isocitrate dehydrogenase [NADP]] [protein_id=CAE42760.1] [location=complement(204636..205892)] [gbkey=CDS]
+ATGTCCTATCAACATATCAAGGTTCCCACTGGGGGCCAAAAAATCACGGTCAACGCCGATTACTCGCTGA
+ATGTGCCCGATCAGGTCATCATTCCGGTCATCGAGGGTGACGGTACGGGCGCCGACATCACGCCGGTGAT
+GATTAAGGTCGTCGACGCGGCCGTGCAGAAGGCCTATGCGGGCAAGCGCAAGATCCACTGGATGGAAGTC
+TACGCCGGCGAGAAGGCCACCAAGGTCTACGGCCCGGACGTCTGGCTGCCCGAGGAAACCCTCGACGCCG
+TCAAGGACTACGTGGTGTCGATCAAGGGTCCGCTGACCACGCCGGTCGGCGGCGGCATCCGTTCGCTGAA
+CGTGGCGCTGCGCCAGCAGCTGGACCTGTATGTCTGCCTGCGCCCGGTGCGCTACTTCAAGGGCGTGCCC
+TCGCCGGTGCGCGAGCCCGAGAAGACCGACATGGTCATCTTCCGCGAGAACTCGGAAGACATCTACGCGG
+GCATCGAGTACATGGCCGAGTCCGAGCAGGCCAAGGACCTGATCCAGTACCTGCAGACCAAGCTGGGCGT
+GACCAAGATCCGCTTCCCGAACACCTCGTCGATCGGCATCAAGCCGGTTTCGCGCGAAGGCACCGAGCGC
+CTGGTGCGCAAGGCGCTGCAGTACGCCATCGACAATGACCGCGCCTCGGTGACCCTGGTCCACAAGGGCA
+ACATCATGAAGTTCACGGAAGGCGGCTTCCGCGACTGGGGCTACGCCCTGGCCCAGAACGAGTTCGGCGC
+GCAGCCGATCGACGGCGGCCCGTGGTGCAAGTTCAAGAATCCCAAGACGGGTCGCGAGATCATCGTCAAG
+GATTCGATCGCCGACGCCTTCCTGCAGCAGATCCTGCTGCGTCCGGCCGAATACGACGTGATCGCCACGC
+TGAACCTGAACGGCGACTACATCTCCGACGCGCTGGCCGCGCAAGTGGGCGGCATCGGCATTGCCCCGGG
+CGCCAACCTGTCGGATTCCGTGGCCATGTTCGAAGCCACCCACGGCACCGCGCCGAAGTACGCGGGCAAG
+GACTACGTGAACCCCGGTTCCGAAATCCTGTCGGCCGAAATGATGCTGCGCCACATGGGCTGGACCGAGG
+CCGCCGACCTGATCATCGCCAGCATGGAGAAATCCATCCTGTCCAAGAAGGTCACCTATGACTTCGCCCG
+TCTGCTCGAAGGCGCCACCCAGGTGTCGTGCTCGGGCTTCGGTCAGGTCATGATCGACAATATGTAA
+>lcl|BX640418.1_cds_CAE42692.1_2372 [gene=pepA] [locus_tag=BP2421] [db_xref=GOA:Q7VW48,InterPro:IPR000819,InterPro:IPR008283,InterPro:IPR011356,InterPro:IPR023042] [protein=cytosol aminopeptidase] [protein_id=CAE42692.1] [location=131847..133346] [gbkey=CDS]
+ATGGAATTTAGCACACAGACCACTGCCTCCCTGCATCAGATCAAGACTGCGGCCCTGGCCGTCGGCGTCT
+TCGCCGACGGCGTGCTCAGCGCCGCCGCCGAAGTCATCGACCGCGCCAGCCACGGTGCCGTGGCCGCCGT
+GGTGAAAAGCGAGTTCCGCGGCCGCACCGGCAGCACGCTGGTGCTGCGCAGCCTGGCCGGCGTCAGCGCC
+CAGCGCGTGGTGCTGGTGGGCCTGGGCAAGCAGGCCGAATACAACGCCCGCGCGCACGCCAGCGCCGAAC
+AGGCGTTCGCCGCGGCGTGCGTCGCGGCCCAGGTGGGCGAAGGCGTGTCGACCCTGGCCGGCGTGGCCAT
+CGAGGGCGTGCCGGTGCGCGCCCGCGCGCGCAGCGCCGCCATCGCCGCGGGCGCGGCGGCCTACCATTAC
+GATGCGACGTTCGGCAAGGCCAATCGCGACGCCCGCCCCAGGTTGAAGAAAATCGTCCAGGTGGTCGACC
+GCGCGGCCTCCGCGCAGGCGCAGCTGGGCCTGCGCGAAGGCGCGGCCATCGCCCACGGCATGGAATTGAC
+CCGCACGCTGGGCAACCTGCCCGGCAACGTGTGCACGCCGGCCTATCTCGGCAATACCGCCAAGAAACTG
+GCGCGCGAATTCAAGAGCCTCAAGGTCGAGGTGCTCGAACGCAAGCAGGTCGAGGCGCTGGGCATGGGCT
+CGTTCCTCTCGGTCGCGCGCGGCTCGGAAGAACCGCTGCGCTTCATCGTGCTGCGCCATGCCGGCAAGCC
+CGCCAAGAAGGACAAGGCCGGCCCGGTCGTCCTGGTGGGCAAGGGCATCACCTTCGATGCTGGCGGCATC
+TCGCTCAAGCCGGCCGCCACGATGGACGAAATGAAGTACGACATGTGCGGCGCGGCCAGCGTGCTGGGCA
+CGTTCCGCGCCCTGGCCGAGCTGGAGCTGCCGCTGGATGTGGTGGGCCTGATCGCGGCGTGCGAGAACCT
+GCCCAGCGGCAAGGCCAACAAGCCCGGCGACGTGGTCACCAGCATGTCGGGCCAGACCATCGAGATCCTC
+AACACCGACGCCGAAGGCCGCCTGGTGCTGTGCGATGCCCTGACCTACGCCGAGCGCTTCAAGCCCGCGG
+CCGTGATCGACATCGCCACGTTGACCGGCGCCTGCGTGGTAGCCCTGGGCAACGTCAATAGCGGCCTGTT
+CTCCAAGGACGACGCGCTGGCCGACGCGCTGCTGGCCGCCAGCCGCCAGTCGCTCGACCCGGCCTGGCGC
+CTGCCGCTGGACGATGCCTACCAGGACCAGCTCAAGTCCAACTTCGCCGACATCGCCAACATCGGCGGCC
+CCCCGGCCGGCGCGGTCACGGCGGCCTGCTTCCTGTCGCGCTTCACCAAGGCTTATCCGTGGGCGCACCT
+GGACATCGCCGGCACGGCCTGGCGCGGCGGCAAGGACAAGGGCGCCACCGGCCGGCCGGTGCCGCTGCTG
+ATGCAGTACCTGCTGGACCAGGCAGGCTGA
+>lcl|BX640420.1_cds_CAE43408.1_3088 [gene=pgm] [locus_tag=BP3141] [db_xref=GOA:Q7VUF5,InterPro:IPR005841,InterPro:IPR005843,InterPro:IPR005844,InterPro:IPR005845,InterPro:IPR005846,InterPro:IPR016055,InterPro:IPR016066,UniProtKB/TrEMBL:Q7VUF5] [protein=phosphoglucomutase] [protein_id=CAE43408.1] [location=217601..218983] [gbkey=CDS]
+GTGGCGCACCCCTTTCCCGCATCGGTCTACAAGGCGTACGACATCCGTGGCTCGGTTCCCGACCAGCTCG
+ACCCGGTATTCGCCCGGGCGCTGGGCCGCGCCCTGGCCGCCAGCGCCCGCGCGCAGGGCATCGGCGCCCT
+GGTGGTCGGCCGCGACGGCCGCCTGAGCAGCCCCGACCTGGCCGGCGCGCTGCAGGAAGGCATCATGGAA
+GGCGGCGTGGACACCCTGGACATCGGCCAGGTGCCCACGCCGCTGGTCTATTTCGCGGCGCACATCCAGG
+GCACGGGCTCGGGCGTGGCGGTCACCGGCAGCCACAACCCGCCGCAGTACAACGGCTTCAAGATGATGAT
+GGGCGGCCAGGCCCTGTACGGCCCGGCCGTGCAGGCGCTGCGCCCGGCCATGCTGGCGCCGGCTGCGGCG
+CCGGGCACCTGGGGCGAACGCCGCCAGCTCGATGTCGTCCCCGCCTATATCGAGCGCATCGTGTCCGACG
+TGAAGCTGGCGCGCCCCATGAAGATCGCCGTCGACTGCGGCAATGGCGTGGCCGGCGCCCTGGCGCCGCA
+ACTGTTCCGCGCGCTGGGTTGCGAAGTGGACGAGCTCTATTGCGAGGTCGACGGCACGTTTCCCAACCAC
+CATCCCGACCCGGCCGAACCGCGCAACCTGCAGGACCTGATCGCCCATGTCACCAGCACCGACTGCGAGC
+TGGGCCTGGCCTTCGACGGCGACGGCGACCGCCTCGGCGTGGTGACCAAGTCCGGCCAGATCATCTGGCC
+CGACCGCCAGCTGATCCTGTTCGCCCGCGACGTGCTGGCCCGCTGTCCCGGCGCGACCATCATCTATGAC
+GTCAAGTGCAGCCAGCACGTGGGCGTGGCCATCGAGCAAAGCGGCGGCGTGCCGCTGATGTGGCAGACTG
+GCCATTCGCTGGTGAAGGCCAAGCTGGCCGAGACCGGCGCGCCGCTGGCCGGCGAGATGAGCGGCCATAT
+CTTCTTCAAGGAGCGCTGGTACGGCTTCGACGACGGCCTGTACACCGGCGCCCGCCTGCTGGAAATCGTC
+TCCCGCGAAACCGATGCGTCGCGCCCGCTGGAGGCCCTGCCGCAGGCGCTGTCGACCCCCGAGCTCAAGC
+TGGAGATGGCCGAGGGCGAGCCGCATGCGCTGATCGCCGCCCTGCAGCAGCAGGGCGAGTTCGCCAGCGC
+CAGCCGGCTGGTTACGATAGACGGCGTGCGCGCGGAATACCCGGACGGCTTCGGGCTGGCGCGCGCCTCC
+AATACCACCCCCGTCGTCGTGCTGCGCTTCGAAGCGGAGACCGAGCCGGGCCTGGCCCGCATCCAGCAGG
+AATTCCGCCAGCAGCTGCTGCGGCTGGCTCCGCAAGCCAAACTGCCCTTCTGA
+>lcl|BX640416.1_cds_CAE42081.1_1761 [gene=tyrB] [locus_tag=BP1795] [db_xref=GOA:Q7VXH5,InterPro:IPR000796,InterPro:IPR004838,InterPro:IPR004839,InterPro:IPR015421,InterPro:IPR015424,UniProtKB/TrEMBL:Q7VXH5] [protein=aromatic-amino-acid aminotransferase] [protein_id=CAE42081.1] [location=complement(151299..152501)] [gbkey=CDS]
+ATGAGCACTCTTTTCGCTTCCGTCGAACTCGCGCCGCGCGACCCCATTCTTGGCCTGAACGAACAGTACA
+ACGCCGATACCCGTCCCGGCAAAGTGAACCTGGGCGTGGGCGTGTACTACGACGACGAAGGCCGCATCCC
+GCTGCTTCAGGCCGTGCGCAAGGCCGAGGTGGCCCGCATCGAAGCCGCCGCCGCCCGCGGCTATCTGCCG
+ATCGAAGGCATCGCGGGGTACAACAAGGGTGCGCAGGCGCTGCTGCTGGGCGCCGACTCGCCGCTGGCCG
+CCGAAGGCCGCGTGCTGACCGCGCAGGCCCTGGGCGGCACCGGCGCGCTGAAGATCGGCGCCGACTTCCT
+GCGCCAGCTGCTGCCGCAGTCCAAGGTCCTCATCAGCGACCCCAGCTGGGAAAACCACCGCGCCCTGTTC
+GAGCGCGCCGGCTTCCCGGTCGAGACCTACGCTTATTACGATGCCGCCACCCATGGCCTGAACTTCGAAG
+CCATGCTGGCCGCCCTGCAGGCCGCGCCCGAACAGACCATCGTGGTGCTGCACGCCTGCTGCCACAACCC
+GACCGGCGTCGATCCCACGCCGCAACAGTGGGAACAGATCGCCGCCGTGGTCAAGGCGCGCAACCTGGTG
+CCGTTCCTCGACATCGCCTACCAGGGCTTCGGCGAAGGCCTGGAGCAGGACGCCGCCGTGGTGCGCATGT
+TCGCCGCGCTCGACCTGACCATGTTCATCAGCTCGTCGTTCTCCAAGTCCTTCTCGCTGTATGGCGAGCG
+GGTCGGGGCCCTGACCGTGGTGGCCGGCAGCAAGGACGAGGCCGCCCGCGTGCTCAGCCAGCTCAAGCGC
+GTGATCCGCACCAACTACTCCAACCCGCCCACCCACGGCGGCACCGTGGTGTCCACGGTCCTGAACACAC
+CCGAGCTGTTCGCGCTCTGGGAAAATGAACTGGCCGGCATGCGCGACCGCATCCGCCTGATGCGCAAGGA
+GCTGGTCGAGAAGATCAAGACCCAGGGCGTGGCGCAGGACTTCAGCTTCGTGCTGGCGCAGCGCGGCATG
+TTCTCGTACTCGGGCCTGACCGCCGCCCAGGTCGATCGCCTGCGCGAAGAGCACGGCATCTACGCGGTCT
+CCAGCGGCCGCATCTGCGTGGCCGCGCTCAACAGCCGCAACATCGACGCGGTCGCGGCCGGCATCGCCGC
+GGTGCTGAAGTAG