bch441-work-abc-units/RPR-Biostrings.R

222 lines
7.1 KiB
R
Raw Normal View History

2017-09-12 20:09:20 +00:00
# RPR-Biostrings.R
#
# Purpose: A Bioinformatics Course:
# R code accompanying the RPR-Biostrings unit.
#
2017-10-22 01:00:55 +00:00
# Version: 1.0
2017-09-12 20:09:20 +00:00
#
2017-10-22 01:00:55 +00:00
# Date: 2017 10 20
2017-09-12 20:09:20 +00:00
# Author: Boris Steipe (boris.steipe@utoronto.ca)
#
# Versions:
2017-10-22 01:00:55 +00:00
# 1.0 2017 Revisions
2017-09-12 20:09:20 +00:00
# 0.1 First code copied from 2016 material.
2017-10-22 01:00:55 +00:00
#
2017-09-12 20:09:20 +00:00
#
# TODO:
#
#
# == DO NOT SIMPLY source() THIS FILE! =======================================
2017-10-22 01:00:55 +00:00
#
2017-09-12 20:09:20 +00:00
# If there are portions you don't understand, use R's help system, Google for an
# answer, or ask your instructor. Don't continue if you don't understand what's
# going on. That's not how it works ...
2017-10-22 01:00:55 +00:00
#
2017-09-12 20:09:20 +00:00
# ==============================================================================
2017-10-22 01:00:55 +00:00
#TOC> ==========================================================================
#TOC>
#TOC> Section Title Line
#TOC> ---------------------------------------------------------
2017-11-03 19:08:17 +00:00
#TOC> 1 The Biostrings Package 52
#TOC> 2 Getting Data into Biostrings Objects 85
#TOC> 3 Working with Biostrings Objects 106
#TOC> 3.1 Properties 109
#TOC> 3.2 Subsetting 146
#TOC> 3.3 Operators 158
#TOC> 3.4 Transformations 165
#TOC> 4 Getting Data out of Biostrings Objects 172
#TOC> 5 More 181
#TOC> 5.1 Views 183
#TOC> 5.2 Iranges 195
#TOC> 5.3 StringSets 201
2017-10-22 01:00:55 +00:00
#TOC>
#TOC> ==========================================================================
2017-09-12 20:09:20 +00:00
2017-10-22 01:00:55 +00:00
# This is a very brief introduction to the biostrings package, other units will
# be using more of the biostrings functions.
2017-11-03 19:08:17 +00:00
# = 1 The Biostrings Package ==============================================
2017-10-22 01:00:55 +00:00
# First, we install and load the Biostrings package from bioconductor
2017-09-12 20:09:20 +00:00
if (! require(Biostrings, quietly=TRUE)) {
if (! exists("biocLite")) {
source("https://bioconductor.org/biocLite.R")
}
2017-09-12 20:09:20 +00:00
biocLite("Biostrings")
library(Biostrings)
}
2017-11-03 19:08:17 +00:00
# Examine the package information:
library(help = Biostrings) # basic information
browseVignettes("Biostrings") # available vignettes
data(package = "Biostrings") # available datasets
2017-10-22 01:00:55 +00:00
# At its core, Biostrings objects are "classes" of type XString (you can think
# of a "class" in R as a special kind of list), that can take on particular
# flavours for RNA, DNA or amino acid sequence information.
class(RNAString("AUG"))
class(DNAString("ATG"))
class(AAString("M"))
# An essential property of Biostrings objects is that they only allow letters
# from the applicable IUPAC alphabet:
RNAString("AUG")
DNAString("AUG") # Error! No "U" in IUPAC DNA codes
# = 2 Getting Data into Biostrings Objects ================================
# Example: read FASTA. Extract sequence. Convert to DNAString object.
x <- readLines("./data/S288C_YDL056W_MBP1_coding.fsa")
x <- dbSanitizeSequence(x)
2017-11-03 19:08:17 +00:00
myDNAseq <- DNAString(x) # takes the nucleotide sequence and converts into a
2017-11-03 19:20:16 +00:00
# object of class DNAstring
2017-10-22 01:00:55 +00:00
2017-11-03 19:08:17 +00:00
# Multi FASTA files can be read directly as a "XStringSet) ...
(myDNASet <- readDNAStringSet("./data/S288C_YDL056W_MBP1_coding.fsa"))
2017-10-22 01:00:55 +00:00
# ... and if you subset one sequence from the set, you get an XString object
2017-11-03 19:08:17 +00:00
# back again.
(Xseq <- myDNASet[[1]])
2017-10-22 01:00:55 +00:00
2017-11-03 19:08:17 +00:00
myDNAseq == Xseq # the comparison evaluates to TRUE ...
identical(myDNAseq, Xseq) # ... and indeed the objects are deemed identical.
2017-10-22 01:00:55 +00:00
# = 3 Working with Biostrings Objects =====================================
# == 3.1 Properties ========================================================
str(myDNAseq)
2017-11-03 19:08:17 +00:00
length(myDNAseq) # This gives you the _number of nucleotides_!
2017-11-03 19:20:16 +00:00
# By comparison ...
2017-10-22 01:00:55 +00:00
length(x) # ... is 1: one string only. To get the number of
2017-11-03 19:20:16 +00:00
# characters in a string, you need nchar().
2017-10-22 01:00:55 +00:00
nchar(x) # However ...
nchar(myDNAseq) # ... also works.
uniqueLetters(myDNAseq)
# Count frequencies - with strings, you would strsplit() into a character
# vector and then use table(). biost
alphabetFrequency(myDNAseq)
2017-09-12 20:09:20 +00:00
2017-10-22 01:00:55 +00:00
# letterFrequency() works with a defined alphabet - such as what uniqueLetters()
# returns.
letterFrequency(myDNAseq, uniqueLetters(myDNAseq))
2017-09-12 20:09:20 +00:00
2017-10-22 01:00:55 +00:00
sum(letterFrequency(myDNAseq, c("G", "C"))) / length(myDNAseq) # GC contents
2017-09-12 20:09:20 +00:00
2017-10-22 01:00:55 +00:00
dinucleotideFrequency(myDNAseq)
barplot(sort(dinucleotideFrequency(myDNAseq)), cex.names = 0.5)
2017-09-12 20:09:20 +00:00
2017-11-03 19:08:17 +00:00
(triNuc <- trinucleotideFrequency(myDNAseq))
barplot(sort(triNuc), col="#4499EE33")
triNuc[triNuc == max(triNuc)]
triNuc[triNuc == min(triNuc)]
max(triNuc) / min(triNuc) # AAA is more than 13 times as frequent as CGT
2017-09-12 20:09:20 +00:00
2017-10-22 01:00:55 +00:00
# compare to a shuffled sequence:
2017-11-03 19:08:17 +00:00
(triNuc <- trinucleotideFrequency(sample(myDNAseq)))
barplot(sort(triNuc), col="#EEEE4433", add = TRUE)
2017-09-12 20:09:20 +00:00
2017-10-22 01:00:55 +00:00
# Interpret this plot.
2017-09-12 20:09:20 +00:00
2017-10-22 01:00:55 +00:00
# == 3.2 Subsetting ========================================================
# Subsetting any XString object works as expected:
myDNAseq[4:15]
# ... well - maybe not expected, because x[4:15] would not work.
# Alternatively to the "[" operator, use the subseq() function - especially for
# long sequences. This is far more efficient.
subseq(myDNAseq, start = 1, end = 30)
# == 3.3 Operators =========================================================
# RNAstring() and DNAstring() objects compare U and T as equals!
RNAString("AUGUCUAACCAAAUAUACUCAGCGAGAUAU") ==
2017-11-03 19:20:16 +00:00
DNAString("ATGTCTAACCAAATATACTCAGCGAGATAT")
2017-10-22 01:00:55 +00:00
# == 3.4 Transformations ===================================================
myDNAseq[4:15]
reverseComplement(myDNAseq[4:15])
translate(myDNAseq[4:15])
# = 4 Getting Data out of Biostrings Objects ==============================
# If you need a character object, use toString():
toString(myDNAseq[4:15])
# save() and load() works like on all other R objects.
# = 5 More ================================================================
# == 5.1 Views =============================================================
# Biostring "Views" are objects that store mutliple substrings of one
# Biostring object.
(myView <- Views(myDNAseq, start = c(1, 19, 37), end = c(15, 30, 45)))
# Views are convenient to store feature annotations
names(myView) <- c("Feature-A", "Feature-B", "Feature-C")
cat(sprintf("\n%s\t(%d)\t%s", names(myView), width(myView), myView ))
# == 5.2 Iranges ===========================================================
# Biostrings Iranges are like Views with a common start point. These can be
# useful for feature annotations. Instead of start/end you store start/width.
# == 5.3 StringSets ========================================================
# Biostring "StringSets" store multiple sequences.
#
ompA <- AAString("MKKTAIAIAVALAGFATVAQA")
sample(ompA) # sample can work directly on a Biostring object to shuffle it
x[1] <- toString(ompA)
for (i in 2:10) {
x[i] <- toString(sample(ompA))
}
shuffledPeptideSet <- AAStringSet(x)
names(shuffledPeptideSet) <- c("ompA", paste("shuffle.", 1:9, sep=""))
shuffledPeptideSet
2017-09-12 20:09:20 +00:00
2017-10-22 01:00:55 +00:00
length(shuffledPeptideSet)
width(shuffledPeptideSet)
alphabetFrequency(shuffledPeptideSet)
2017-09-12 20:09:20 +00:00
# [END]