Added Galaxy repo as a submodule

Added personal development channel to planemo serve and lint VSCode tasks
Moved actual tool definition to submodule
2025-03-06 09:43:26 -06:00 · 2025-02-27 21:12:24 +00:00 · 2025-02-26 21:08:12 +00:00 · 2025-02-25 23:09:27 +00:00 · 2025-02-25 16:50:27 +00:00 · 2025-02-25 16:46:24 +00:00
17 changed files with 23 additions and 58846 deletions
--- a/.devcontainer/devcontainer.json
+++ b/.devcontainer/devcontainer.json
@@ -3,7 +3,7 @@
 {
 	"name": "Python 3",
 	// Or use a Dockerfile or Docker Compose file. More info: https://containers.dev/guide/dockerfile
-	"image": "mcr.microsoft.com/devcontainers/python:1-3.12-bullseye",
+	"image": "mcr.microsoft.com/devcontainers/python:1-3.11-bullseye",

 	// Features to add to the dev container. More info: https://containers.dev/features.
 	// "features": {},
--- a/.gitignore
+++ b/.gitignore
@@ -1,2 +1,3 @@
 galaxy-server/**
 test_results
+autobigs-cli_test_report.html
--- a/.gitmodules
+++ b/.gitmodules
@@ -0,0 +1,6 @@
+[submodule "auto-updated-tools-iuc"]
+	path = auto-updated-tools-iuc
+	url = https://github.com/Syph-and-VPD-Lab/auto-updated-tools-iuc.git
+[submodule "galaxy"]
+	path = galaxy
+	url = https://github.com/galaxyproject/galaxy.git
--- a/.shed.yml
+++ b/.shed.yml
@@ -1,12 +0,0 @@
-name: autobigs
-owner: ydeng
-description: Automated MLST typing from PubMLST and InstitutPasteur.
-homepage_url: https://github.com/Syph-and-VPD-Lab/autoBIGS.cli
-long_description: |
-  A program that allows quickly batched requests for obtaining MLST 
-  profiles on multiple FASTA sequences and exporting it as a convenient 
-  CSV. Capable of querying a variety of MLST databases from both 
-  Institut Pasteur and PubMLST.
-remote_repository_url: https://github.com/Syph-and-VPD-Lab/autoBIGS.cli
-categories:
- Sequence Analysis
--- a/.vscode/extensions.json
+++ b/.vscode/extensions.json
@@ -2,6 +2,7 @@
    "recommendations": [
        "mechatroner.rainbow-csv",
        "redhat.vscode-xml",
-        "ms-vscode.live-server"
+        "ms-vscode.live-server",
+        "davelopez.galaxy-tools"
    ]
 }
--- a/.vscode/tasks.json
+++ b/.vscode/tasks.json
@@ -6,19 +6,19 @@
        {
            "label": "lint",
            "type": "shell",
-            "command": "planemo lint",
+            "command": "planemo lint auto-updated-tools-iuc/tools/autobigs",
            "problemMatcher": []
        },
        {
            "label": "serve",
            "type": "shell",
-            "command": "planemo serve",
+            "command": "planemo serve auto-updated-tools-iuc/tools/autobigs --conda_channels https://git.reslate.systems/api/packages/ydeng/conda,bioconda,conda-forge",
            "problemMatcher": []
        },
        {
            "label": "run tests",
            "type": "shell",
-            "command": "planemo test autobigs-cli.xml --test_output_junit test_results/junit_results.xml --test_output_json test_results/results.json --test_output test_results/human.html",
+            "command": "planemo test auto-updated-tools-iuc/tools/autobigs/autobigs-cli.xml --test_output_junit test_results/junit_results.xml --test_output_json test_results/results.json --test_output test_results/human.html --conda_channels https://git.reslate.systems/api/packages/ydeng/conda,bioconda,conda-forge",
            "problemMatcher": []
        }
    ]
--- a/17
+++ b/17
@@ -2,29 +2,28 @@ pipeline {
    agent {
        kubernetes {
            cloud 'rsys-devel'
-            defaultContainer 'miniforge3'
-            inheritFrom 'miniforge'
+            defaultContainer 'pip'
+            inheritFrom 'pip'
        }
    }
    
    stages {
        stage ("install") {
            steps {
-                sh 'conda env update -n base --file environment.yml'
-                sh 'useradd galaxy -m'
-                sh 'apt-get update'
-                sh 'apt-get install sudo -y'
+                sh 'pip install -r requirements.txt'
+                sh 'pip install standard-imghdr'
+                sh 'planemo ci_setup'
            }
        }
        stage ("lint") {
            steps {
-                sh "sudo -u galaxy planemo lint autobigs-cli.xml"
+                sh "planemo lint autobigs-cli.xml"
            }
        }
        stage ("test") {
            steps {
-                sh 'sudo -u galaxy mkdir test_results'
-                sh "sudo -u galaxy planemo test autobigs-cli.xml --test_output_junit test_results/junit_results.xml --test_output_json test_results/results.json --test_output test_results/human.html"
+                sh 'mkdir test_results'
+                sh "planemo test autobigs-cli.xml --test_output_junit test_results/junit_results.xml --test_output_json test_results/results.json --test_output test_results/human.html"
                xunit checksName: '', tools: [JUnit(excludesPattern: '', pattern: 'test_results/junit_report.xml', stopProcessingIfError: true)]
            }
        }
--- a/1
+++ b/1
--- a/autobigs-cli.xml
+++ b/autobigs-cli.xml
@@ -1,142 +0,0 @@
-<tool id="autobigs-cli" name="autoBIGS.cli" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="21.05">
-	<description>Automated MLST typing from PubMLST and InstitutPasteur.</description>
-	<macros>
-		<token name="@TOOL_VERSION@">0.5.0</token>
-		<token name="@VERSION_SUFFIX@">0</token>
-    	<import>autobigs-cli_macros.xml</import>
-	    <expand macro="bio_tools"/>
-	</macros>
-
-	<requirements>
-		<requirement type="package" version="@TOOL_VERSION@">autobigs-cli</requirement>
-	</requirements>
-
-	<command detect_errors="exit_code"><![CDATA[
-			#if $mode.operation == "info":
-				#if $mode.select_info.retrieved == "schemes":
-					autoBIGS info --retrieve-bigsdb-schemas#for $scheme in $mode.select_info.schemes_list# '${scheme.selected_db}' #end for# --csv $info_schemes_out
-				#else if $mode.select_info.retrieved == "databases":
-					autoBIGS info --retrieve-bigsdbs --csv $info_db_out
-				#end if
-			#else if $mode.operation == "st":
-				autoBIGS st#for $fasta in $mode.fastas_list# '${fasta.fasta}' #end for#"$seqdefdb" $schema "$mlst_profiles_output" $stop_on_fail
-			#end if
-	]]></command>
-	<inputs>
-		<conditional name="mode">
-			<param name="operation" label="Operation" type="select">
-				<option value="info">Retrieve Database Information</option>
-				<option value="st">Perform Sequence Typing</option>
-			</param>
-			<when value="info">
-				<conditional name="select_info">
-					<param name="retrieved" label="Schemes or Database List" type="select">
-						<option value="schemes">Available Schemas for Database</option>
-						<option value="databases">Available Databases</option>
-					</param>
-					<when value="schemes">
-						<repeat name="schemes_list" title="Schemes" min="1">
-							<param name="selected_db" argument="--retrieve-bigsdb-schemas" label="Database to retrieve schemes from" type="text"/>
-						</repeat>
-					</when>
-					<when value="databases">
-
-					</when>
-				</conditional>
-			</when>
-			<when value="st">
-				<repeat name="fastas_list" title="Fasta" min="1">
-					<param name="fasta" label="FASTA file" type="data" format="fasta,fas,fa,fna,ffn,faa,mpfa,frn"/>
-				</repeat>
-				<param name="seqdefdb" label="BIGSdb SeqDef Name" type="text" optional="false"/>
-				<param name="schema" label="BIGSdb SeqDef Schema ID" type="integer" min="0"/>
-				<param name="stop_on_fail" label="Stop on failure to match" truevalue="--sof" falsevalue="" value="false" type="boolean"/>
-			</when>
-		</conditional>
-	</inputs>
-	<outputs>
-		<data name="mlst_profiles_output" label="${tool.name} on ${on_string}" format="csv">
-			<filter>mode['operation'] == 'st'</filter>
-		</data>
-		<data name="info_db_out" label="${tool.name} supported Databases" format="csv">
-			<filter>mode['operation'] == 'info' and mode['select_info']['retrieved'] == 'databases'</filter>
-		</data>
-		<data name="info_schemes_out" label="${tool.name} supported Schemes" format="csv">
-			<filter>mode['operation'] == 'info' and mode['select_info']['retrieved'] == 'schemes'</filter>
-		</data>
-	</outputs>
-    <tests>
-        <test expect_num_outputs="1">
-            <param name="operation" value="st" />
-			<repeat name="fastas_list">
-	            <param name="fasta" value="tohama_I_minimized_features.fasta" />
-			</repeat>
-            <param name="seqdefdb" value="pubmlst_bordetella_seqdef" />
-            <param name="schema" value="3" />
-            <output name="mlst_profiles_output" file="tohama_I_minimized_features_typed.csv" ftype="csv" />
-        </test>
-        <test expect_num_outputs="1">
-            <param name="operation" value="info" />
-            <param name="retrieved" value="databases" />
-            <output name="info_db_out">
-				<assert_contents>
-					<has_text text="BIGSdb Names,Source"/>
-					<has_text text="pubmlst_bordetella_seqdef,https://bigsdb.pasteur.fr/api"/>
-				</assert_contents>
-			</output>
-        </test>
-        <test expect_num_outputs="1">
-            <param name="operation" value="info" />
-			<repeat name="schemes_list">
-            	<param name="selected_db" value="pubmlst_bordetella_seqdef" />
-			</repeat>
-            <output name="info_schemes_out">
-				<assert_contents>
-					<has_text text="Name,ID"/>
-					<has_text text="MLST,3"/>
-				</assert_contents>
-			</output>
-        </test>
-    </tests>
-	<help><![CDATA[
-
-usage: autoBIGS info [-h] [--retrieve-bigsdbs] [--retrieve-bigsdb-schemas LIST_BIGSDB_SCHEMAS [LIST_BIGSDB_SCHEMAS ...]] [--csv CSV_OUTPUT]
-
-Fetches the latest BIGSdb MLST database definitions.
-
-options:
-  -h, --help            show this help message and exit
-  --retrieve-bigsdbs, -l
-                        Lists all known BIGSdb MLST databases (fetched from known APIs and cached).
-  --retrieve-bigsdb-schemas LIST_BIGSDB_SCHEMAS
-                        Lists the known schema IDs for a given BIGSdb sequence definition database name. The name, and then the ID of the schema is given.
-  --csv, -o CSV_OUTPUT  Output list as CSV at a given path. A suffix is added depending on the action taken.
-
-usage: autoBIGS st [-h] [--stop-on-fail] fastas [fastas ...] seqdefdb schema out
-
-Returns MLST exact profile matches.
-
-positional arguments:
-  fastas                The FASTA files to process. Multiple can be listed.
-  seqdefdb              The BIGSdb seqdef database to use for typing.
-  schema                The BIGSdb seqdef database schema ID (integer) to use for typing.
-  out                   The output CSV name (.csv will be appended).
-
-options:
-  -h, --help            show this help message and exit
-  --stop-on-fail, -sof  Should the algorithm stop in the case there are no matches (or partial matches when expecting exact matches).
-	]]></help>
-    <citations>
-        <citation type="bibtex">
-@book{Deng2025RealYHD,
-title = {Syph-and-VPD-Lab/autoBIGS.cli},
-url = {https://github.com/Syph-and-VPD-Lab/autoBIGS.cli},
-author = {Deng, Harrison},
-date = {2025-01-24},
-year = {2025},
-month = {1},
-day = {24},
-}
-        </citation>
-    </citations>
-</tool>
--- a/autobigs-cli_macros.xml
+++ b/autobigs-cli_macros.xml
@@ -1,7 +0,0 @@
-<macros>
-  <xml name="bio_tools">
-    <xrefs>
-        <xref type="bio.tools">AutoBIGS.CLI</xref>
-    </xrefs>
-  </xml>
-</macros>
--- a/1
+++ b/1
--- a/test-data/databases-2025-02-21.csv
+++ b/test-data/databases-2025-02-21.csv
@@ -1,146 +0,0 @@
-BIGSdb Names,Source
-pubmlst_aactinomycetemcomitans_seqdef,https://rest.pubmlst.org
-pubmlst_abaumannii_seqdef,https://rest.pubmlst.org
-pubmlst_achromobacter_seqdef,https://rest.pubmlst.org
-pubmlst_aeromonas_seqdef,https://rest.pubmlst.org
-pubmlst_afumigatus_seqdef,https://rest.pubmlst.org
-pubmlst_aparagallinarum_seqdef,https://rest.pubmlst.org
-pubmlst_aphagocytophilum_seqdef,https://rest.pubmlst.org
-pubmlst_arcobacter_seqdef,https://rest.pubmlst.org
-pubmlst_bbacilliformis_seqdef,https://rest.pubmlst.org
-pubmlst_bcc_seqdef,https://rest.pubmlst.org
-pubmlst_bcereus_seqdef,https://rest.pubmlst.org
-pubmlst_bfragilis_seqdef,https://rest.pubmlst.org
-pubmlst_bhenselae_seqdef,https://rest.pubmlst.org
-pubmlst_blastocystis_seqdef,https://rest.pubmlst.org
-pubmlst_blicheniformis_seqdef,https://rest.pubmlst.org
-pubmlst_bmallei_seqdef,https://rest.pubmlst.org
-pubmlst_bordetella_seqdef,https://bigsdb.pasteur.fr/api
-pubmlst_borrelia_seqdef,https://rest.pubmlst.org
-pubmlst_bpseudomallei_seqdef,https://rest.pubmlst.org
-pubmlst_brachyspira_seqdef,https://rest.pubmlst.org
-pubmlst_brucella_seqdef,https://rest.pubmlst.org
-pubmlst_bsubtilis_seqdef,https://rest.pubmlst.org
-pubmlst_bwashoensis_seqdef,https://rest.pubmlst.org
-pubmlst_calbicans_seqdef,https://rest.pubmlst.org
-pubmlst_campylobacter_nonjejuni_seqdef,https://rest.pubmlst.org
-pubmlst_campylobacter_seqdef,https://rest.pubmlst.org
-pubmlst_cbotulinum_seqdef,https://rest.pubmlst.org
-pubmlst_cchauvoei_seqdef,https://rest.pubmlst.org
-pubmlst_cdifficile_seqdef,https://rest.pubmlst.org
-pubmlst_cfreundii_seqdef,https://rest.pubmlst.org
-pubmlst_cglabrata_seqdef,https://rest.pubmlst.org
-pubmlst_chlamydiales_seqdef,https://rest.pubmlst.org
-pubmlst_ckrusei_seqdef,https://rest.pubmlst.org
-pubmlst_cmaltaromaticum_seqdef,https://rest.pubmlst.org
-pubmlst_cperfringens_seqdef,https://rest.pubmlst.org
-pubmlst_cronobacter_seqdef,https://rest.pubmlst.org
-pubmlst_csepticum_seqdef,https://rest.pubmlst.org
-pubmlst_csinensis_seqdef,https://rest.pubmlst.org
-pubmlst_ctropicalis_seqdef,https://rest.pubmlst.org
-pubmlst_diphtheria_seqdef,https://bigsdb.pasteur.fr/api
-pubmlst_dnodosus_seqdef,https://rest.pubmlst.org
-pubmlst_ecloacae_seqdef,https://rest.pubmlst.org
-pubmlst_edwardsiella_seqdef,https://rest.pubmlst.org
-pubmlst_efaecalis_seqdef,https://rest.pubmlst.org
-pubmlst_efaecium_seqdef,https://rest.pubmlst.org
-pubmlst_escherichia_seqdef,https://rest.pubmlst.org
-pubmlst_fpsychrophilum_seqdef,https://rest.pubmlst.org
-pubmlst_gallibacterium_seqdef,https://rest.pubmlst.org
-pubmlst_geotrichum_seqdef,https://rest.pubmlst.org
-pubmlst_hcinaedi_seqdef,https://rest.pubmlst.org
-pubmlst_helicobacter_seqdef,https://rest.pubmlst.org
-pubmlst_hinfluenzae_seqdef,https://rest.pubmlst.org
-pubmlst_hparasuis_seqdef,https://rest.pubmlst.org
-pubmlst_hsuis_seqdef,https://rest.pubmlst.org
-pubmlst_kaerogenes_seqdef,https://rest.pubmlst.org
-pubmlst_klebsiella_seqdef,https://bigsdb.pasteur.fr/api
-pubmlst_koxytoca_seqdef,https://rest.pubmlst.org
-pubmlst_kseptempunctata_seqdef,https://rest.pubmlst.org
-pubmlst_leptospira_seqdef,https://rest.pubmlst.org
-pubmlst_lgarvieae_seqdef,https://rest.pubmlst.org
-pubmlst_liberibacter_seqdef,https://rest.pubmlst.org
-pubmlst_listeria_seqdef,https://bigsdb.pasteur.fr/api
-pubmlst_llactis_phage_seqdef,https://rest.pubmlst.org
-pubmlst_lsalivarius_seqdef,https://rest.pubmlst.org
-pubmlst_mabscessus_seqdef,https://rest.pubmlst.org
-pubmlst_magalactiae_seqdef,https://rest.pubmlst.org
-pubmlst_manserisalpingitidis_seqdef,https://rest.pubmlst.org
-pubmlst_mbovis_seqdef,https://rest.pubmlst.org
-pubmlst_mcanis_seqdef,https://rest.pubmlst.org
-pubmlst_mcaseolyticus_seqdef,https://rest.pubmlst.org
-pubmlst_mflocculare_seqdef,https://rest.pubmlst.org
-pubmlst_mgallisepticum_seqdef,https://rest.pubmlst.org
-pubmlst_mgenitalium_seqdef,https://rest.pubmlst.org
-pubmlst_mhaemolytica_seqdef,https://rest.pubmlst.org
-pubmlst_mhominis_seqdef,https://rest.pubmlst.org
-pubmlst_mhyopneumoniae_seqdef,https://rest.pubmlst.org
-pubmlst_mhyorhinis_seqdef,https://rest.pubmlst.org
-pubmlst_mhyosynoviae_seqdef,https://rest.pubmlst.org
-pubmlst_miowae_seqdef,https://rest.pubmlst.org
-pubmlst_mplutonius_seqdef,https://rest.pubmlst.org
-pubmlst_mpneumoniae_seqdef,https://rest.pubmlst.org
-pubmlst_msciuri_seqdef,https://rest.pubmlst.org
-pubmlst_msynoviae_seqdef,https://rest.pubmlst.org
-pubmlst_mycobacteria_seqdef,https://rest.pubmlst.org
-pubmlst_neisseria_seqdef,https://rest.pubmlst.org
-pubmlst_oralstrep_seqdef,https://rest.pubmlst.org
-pubmlst_orhinotracheale_seqdef,https://rest.pubmlst.org
-pubmlst_otsutsugamushi_seqdef,https://rest.pubmlst.org
-pubmlst_pacnes_seqdef,https://rest.pubmlst.org
-pubmlst_paeruginosa_seqdef,https://rest.pubmlst.org
-pubmlst_pdamselae_seqdef,https://rest.pubmlst.org
-pubmlst_pfluorescens_seqdef,https://rest.pubmlst.org
-pubmlst_pgingivalis_seqdef,https://rest.pubmlst.org
-pubmlst_plarvae_seqdef,https://rest.pubmlst.org
-pubmlst_plasmid_seqdef,https://rest.pubmlst.org
-pubmlst_pmultocida_seqdef,https://rest.pubmlst.org
-pubmlst_ppentosaceus_seqdef,https://rest.pubmlst.org
-pubmlst_pputida_seqdef,https://rest.pubmlst.org
-pubmlst_proteus_seqdef,https://rest.pubmlst.org
-pubmlst_psalmonis_seqdef,https://rest.pubmlst.org
-pubmlst_ranatipestifer_seqdef,https://rest.pubmlst.org
-pubmlst_rhodococcus_seqdef,https://rest.pubmlst.org
-pubmlst_rmlst_seqdef,https://rest.pubmlst.org
-pubmlst_sagalactiae_seqdef,https://rest.pubmlst.org
-pubmlst_salmonella_seqdef,https://rest.pubmlst.org
-pubmlst_saureus_seqdef,https://rest.pubmlst.org
-pubmlst_sbsec_seqdef,https://rest.pubmlst.org
-pubmlst_scanis_seqdef,https://rest.pubmlst.org
-pubmlst_schromogenes_seqdef,https://rest.pubmlst.org
-pubmlst_sdysgalactiae_seqdef,https://rest.pubmlst.org
-pubmlst_sepidermidis_seqdef,https://rest.pubmlst.org
-pubmlst_serratia_seqdef,https://rest.pubmlst.org
-pubmlst_sgallolyticus_seqdef,https://rest.pubmlst.org
-pubmlst_shaemolyticus_seqdef,https://rest.pubmlst.org
-pubmlst_shewanella_seqdef,https://rest.pubmlst.org
-pubmlst_shominis_seqdef,https://rest.pubmlst.org
-pubmlst_siniae_seqdef,https://rest.pubmlst.org
-pubmlst_sinorhizobium_seqdef,https://rest.pubmlst.org
-pubmlst_smaltophilia_seqdef,https://rest.pubmlst.org
-pubmlst_smitis_seqdef,https://rest.pubmlst.org
-pubmlst_sparasitica_seqdef,https://rest.pubmlst.org
-pubmlst_spneumoniae_seqdef,https://rest.pubmlst.org
-pubmlst_spseudintermedius_seqdef,https://rest.pubmlst.org
-pubmlst_spyogenes_seqdef,https://rest.pubmlst.org
-pubmlst_ssuis_seqdef,https://rest.pubmlst.org
-pubmlst_sthermophilus_seqdef,https://rest.pubmlst.org
-pubmlst_streptomyces_seqdef,https://rest.pubmlst.org
-pubmlst_suberis_seqdef,https://rest.pubmlst.org
-pubmlst_szooepidemicus_seqdef,https://rest.pubmlst.org
-pubmlst_taylorella_seqdef,https://rest.pubmlst.org
-pubmlst_tenacibaculum_seqdef,https://rest.pubmlst.org
-pubmlst_test_seqdef,https://rest.pubmlst.org
-pubmlst_tpallidum_seqdef,https://rest.pubmlst.org
-pubmlst_tvaginalis_seqdef,https://rest.pubmlst.org
-pubmlst_ureaplasma_seqdef,https://rest.pubmlst.org
-pubmlst_vcholerae_seqdef,https://rest.pubmlst.org
-pubmlst_vibrio_seqdef,https://rest.pubmlst.org
-pubmlst_vparahaemolyticus_seqdef,https://rest.pubmlst.org
-pubmlst_vtapetis_seqdef,https://rest.pubmlst.org
-pubmlst_vvulnificus_seqdef,https://rest.pubmlst.org
-pubmlst_wolbachia_seqdef,https://rest.pubmlst.org
-pubmlst_xcitri_seqdef,https://rest.pubmlst.org
-pubmlst_xfastidiosa_seqdef,https://rest.pubmlst.org
-pubmlst_yersinia_seqdef,https://bigsdb.pasteur.fr/api
-pubmlst_yruckeri_seqdef,https://rest.pubmlst.org
--- a/test-data/schemas-2025-02-21.csv
+++ b/test-data/schemas-2025-02-21.csv
@@ -1,11 +0,0 @@
-Name,ID
-Autotransporters,11
-Bp_vaccine antigens,7
-MLST,3
-Other toxins,9
-PRN-test-Bp,5
-Phase,8
-T3SS,10
-cgMLST_genus,1
-cgMLST_pertussis,4
-macrolide resistance,6
--- a/test-data/tohama_I_bpertussis_wgs.fasta
+++ b/test-data/tohama_I_bpertussis_wgs.fasta
--- a/test-data/tohama_I_bpertussis_wgs_typed.csv
+++ b/test-data/tohama_I_bpertussis_wgs_typed.csv
@@ -1,2 +0,0 @@
-id,st,clonal-complex,adk,fumC,glyA,icd,pepA,pgm,tyrB
-BX470248.1,1,ST-2 complex,1,1,1,1,1,1,1
--- a/test-data/tohama_I_minimized_features.fasta
+++ b/test-data/tohama_I_minimized_features.fasta
@@ -1,133 +0,0 @@
->lcl|BX640419.1_cds_CAE43044.1_2724 [gene=adK] [locus_tag=BP2769] [db_xref=GOA:P0DKX8,InterPro:IPR000850,InterPro:IPR006259,InterPro:IPR007862,InterPro:IPR027417] [protein=adenylate kinase] [protein_id=CAE43044.1] [location=164032..164688] [gbkey=CDS]
-ATGCGTCTCATTCTGCTCGGACCGCCCGGAGCCGGCAAAGGCACCCAAGCCGCCTTTCTCACCCAACACT
-ACGGCATCCCGCAGATATCCACCGGTGACATGCTGCGCGCCGCCGTCAAGGCCGGCACGCCGCTGGGCCT
-GGAAGCCAAGAAGGTCATGGACGCGGGCGGCCTGGTCTCGGACGACCTGATCATCGGCCTGGTGCGCGAT
-CGCCTGACCCAGCCCGATTGCGCCAACGGCTACCTGTTCGACGGTTTCCCGCGCACCATCCCGCAGGCCG
-ACGCGCTCAAGAGCGCCGGCATCGCGCTGGATTACGTGGTCGAGATCGAAGTGCCGGAAAGCGACATCAT
-CGAACGCATGAGCGAACGCCGCGTGCACCCGGCCAGCGGCCGCAGCTACCACGTACGCTTCAATCCGCCC
-AAGGCCGAAGGCGTGGACGACGTCACGGGCGAACCGCTGGTGCAGCGCGACGACGACCGCGAGGAAACCG
-TGCGCCATCGTCTCAACGTCTACCAGAACCAGACCCGCCCGCTGGTCGACTACTACTCGTCCTGGGCCCA
-GTCCGATGCCGCCGCGGCGCCCAAGTACCGCAAGATCTCCGGCGTCGGCTCGGTCGACGAAATCAAGAGC
-CGCCTGTCGCAGGCTCTGCAGAGCTAA
->lcl|BX640411.1_cds_CAE40628.1_248 [gene=fumC] [locus_tag=BP0248] [db_xref=GOA:Q7W0A2,InterPro:IPR000362,InterPro:IPR005677,InterPro:IPR008948,InterPro:IPR018951,InterPro:IPR020557,InterPro:IPR022761,InterPro:IPR024083] [protein=fumarate hydratase class II] [protein_id=CAE40628.1] [location=256543..257934] [gbkey=CDS]
-ATGAAAACCCGCACCGAAAAAGACACTTTCGGCCCGATCGAGGTGCCCGAGCAGCACCTGTGGGGCGCGC
-AGACCCAGCGCTCGCTGCATTTCTTCGCGATCTCGACCGAGAAGATGCCGGTGCCGCTGGTCGCCGCCAT
-GGCACGCCTGAAGCGCGCCGCCGCCAAGGTCAACGCCGAGCTGGGCGAGCTGGATCCGCAGGTCGCAGAC
-GCCATCATGCGGGCCGCCGATGAGGTGATCGCCGGCAAGTGGCCCGACGAGTTTCCGCTGTCGGTCTGGC
-AGACCGGCTCGGGCACGCAGAGCAACATGAACATGAACGAGGTGCTGGCCAACCGCGCCTCCGAGCTGCT
-GGGCGGCGAGCGCGGCGAAGGCCGCAAGGTGCACCCCAACGACCACGTGAACCGGGGCCAGTCGTCCAAC
-GATACCTTTCCGACCGCCATGCACGTGGCCGCCGCGGTCGAGGTCGAGCACCGCGTGCTGCCCGCCCTGA
-AGGCGTTGCGCGGCACGCTGGCCGCCAAGAGCGCGGCGTTCTACGACATCGTCAAGATCGGTCGCACCCA
-TTTGCAGGACGCCACCCCGTTGACGCTGGGCCAGGAGATCTCCGGCTACGTGGCGCAGCTGGACCTGGCC
-GAGCAGCAGATCCGCGCGACGCTGGCCGGCCTGCACCAGCTGGCCATCGGCGGCACGGCGGTGGGCACCG
-GCCTGAACGCGCATCCGCAGTTCAGCGCCAAGGTATCGGCCGAACTGGCCCATGACACGGGCAGCGCGTT
-CGTGTCGGCGCCCAACAAGTTCCAGGCGCTGGCTTCGCACGAGGCGCTGCTGTTCGCGCACGGCGCCTTG
-AAGACGCTGGCCGCCGGCCTGATGAAGATCGCCAACGATGTGCGCTGGCTGGCCAGCGGCCCGCGCTCGG
-GGCTGGGCGAAATCAGCATTCCCGAGAACGAGCCGGGCAGCTCCATCATGCCGGGCAAGGTCAACCCGAC
-CCAGTGCGAAGCCGTCACGATGCTGGCCGCGCAGGTCATGGGCAACGACGTGGCCATCAATGTCGGCGGG
-GCCAGCGGCAACTTCGAGCTGAACGTCTTCAAGCCGCTGGTGATCCACAATTTCCTGCAGTCGGTGCGCC
-TGCTGGCCGACGGCATGGTCAGCTTCGACAAGCACTGCGCGGCCGGCATCGAGCCCAACCGCGAGCGCAT
-CACCGAGCTGGTCGAGCGTTCGCTGATGCTGGTGACTGCGCTCAACCCGCACATCGGCTACGACAAGGCC
-GCGCAGATCGCCAAGAAGGCGCACAAGGAAAACCTGTCGCTGAAAGAGGCGGCGCTGGCGCTGGGGCACC
-TGACCGAGGCGCAGTTCGCCGAGTGGGTGGTGCCGGGCGACATGACCAACGCGCGCCGCTAG
->lcl|BX640420.1_cds_CAE43224.1_2904 [gene=glyA] [locus_tag=BP2952] [db_xref=GOA:Q7VUW7,InterPro:IPR001085,InterPro:IPR015421,InterPro:IPR015422,InterPro:IPR015424,InterPro:IPR019798] [protein=serine hydroxymethyltransferase] [protein_id=CAE43224.1] [location=complement(8611..9858)] [gbkey=CDS]
-ATGTTCAACCGCAACCTGACCCTCGACCAGGTGGATCCCGACGTCTGGGCCGCCATCCAGAAAGAAGACG
-TACGCCAGGAACAGCACATCGAGCTGATCGCGTCCGAGAACTACGCCAGCCCCGCCGTGATGCAGGCCCA
-GGGCACGCAACTGACCAACAAGTATGCGGAAGGCTACCCGGGCAAGCGCTACTACGGCGGTTGCGAGTAC
-GTCGACGTGGTCGAGCAGCTGGCCATCGACCGCCTGAAGCAGATTTTCGGCGCCGAGGCCGCCAACGTGC
-AGCCGAACTCCGGCTCGCAGGCCAACCAGGGCGTGTACATGGCGGTGCTCAAGCCGGGCGATACCGTGCT
-GGGCATGAGCCTGGCCGAAGGCGGTCACCTGACGCACGGCGCGTCGGTCAACGCCTCGGGCAAGCTGTAC
-AACTTCGTGCCCTACGGCCTGGACGCCGACGAGGTGCTGGACTACGCCCAGGTCGAGCGGCTGACCAAGG
-AACACAAGCCCAAGCTGATCGTGGCCGGCGCCTCCGCGTACGCGCTGCACATCGACTTCGAGCGCATGGC
-GCGCATCGCCCACGACAACGGCGCGCTGTTCATGGTGGACATCGCCCACTATGCCGGCCTGGTGGCCGGC
-GGCGCCTATCCCAACCCGGTGCCGCACGCCGATTTCGTCACCTCCACCACGCACAAGTCGCTGCGCGGCC
-CGCGCGGCGGCGTCATCATGATGAAGGCCGAGTTCGAGAAGGCCGTCAATTCGGCCATCTTCCCGGGCAT
-CCAGGGCGGTCCGCTGATGCACGTCATCGCGGCCAAGGCCGTGGCCTTCAAGGAAGCGCTGTCGCCCGAG
-TTCCAGGATTACGCCCAGCAGGTCGTCAAGAACGCCAAGGTGCTGGCCGATACGCTGGTCAAGCGCGGCC
-TGCGCATCGTGTCGGGCAGGACCGAAAGCCACGTCATGCTGGTGGACCTGCGTCCCAAGGGCATTACCGG
-CAAGGAAGCGGAAGCGGTGCTGGGCCAGGCCCACATCACGGTCAACAAGAACGCCATTCCCAACGACCCG
-GAAAAGCCCTTCGTGACCAGCGGCATCCGCCTGGGCACTCCGGCCATGACCACCCGCGGCTTCAAGGAGG
-CCGAGGCCGAGCTGACCGCCAACCTGATCGCCGACGTGCTGGACAATCCGCGCGACGAGGCGAACATCGC
-CGCGGTGCGCGCGCGGGTCAATGAACTGACCGCCCGCCTGCCCGTCTACGGCAACTGA
->lcl|BX640418.1_cds_CAE42760.1_2440 [gene=icd] [locus_tag=BP2488] [db_xref=GOA:Q7VVZ2,InterPro:IPR001804,InterPro:IPR004439,InterPro:IPR019818,InterPro:IPR024084,UniProtKB/TrEMBL:Q7VVZ2] [protein=isocitrate dehydrogenase [NADP]] [protein_id=CAE42760.1] [location=complement(204636..205892)] [gbkey=CDS]
-ATGTCCTATCAACATATCAAGGTTCCCACTGGGGGCCAAAAAATCACGGTCAACGCCGATTACTCGCTGA
-ATGTGCCCGATCAGGTCATCATTCCGGTCATCGAGGGTGACGGTACGGGCGCCGACATCACGCCGGTGAT
-GATTAAGGTCGTCGACGCGGCCGTGCAGAAGGCCTATGCGGGCAAGCGCAAGATCCACTGGATGGAAGTC
-TACGCCGGCGAGAAGGCCACCAAGGTCTACGGCCCGGACGTCTGGCTGCCCGAGGAAACCCTCGACGCCG
-TCAAGGACTACGTGGTGTCGATCAAGGGTCCGCTGACCACGCCGGTCGGCGGCGGCATCCGTTCGCTGAA
-CGTGGCGCTGCGCCAGCAGCTGGACCTGTATGTCTGCCTGCGCCCGGTGCGCTACTTCAAGGGCGTGCCC
-TCGCCGGTGCGCGAGCCCGAGAAGACCGACATGGTCATCTTCCGCGAGAACTCGGAAGACATCTACGCGG
-GCATCGAGTACATGGCCGAGTCCGAGCAGGCCAAGGACCTGATCCAGTACCTGCAGACCAAGCTGGGCGT
-GACCAAGATCCGCTTCCCGAACACCTCGTCGATCGGCATCAAGCCGGTTTCGCGCGAAGGCACCGAGCGC
-CTGGTGCGCAAGGCGCTGCAGTACGCCATCGACAATGACCGCGCCTCGGTGACCCTGGTCCACAAGGGCA
-ACATCATGAAGTTCACGGAAGGCGGCTTCCGCGACTGGGGCTACGCCCTGGCCCAGAACGAGTTCGGCGC
-GCAGCCGATCGACGGCGGCCCGTGGTGCAAGTTCAAGAATCCCAAGACGGGTCGCGAGATCATCGTCAAG
-GATTCGATCGCCGACGCCTTCCTGCAGCAGATCCTGCTGCGTCCGGCCGAATACGACGTGATCGCCACGC
-TGAACCTGAACGGCGACTACATCTCCGACGCGCTGGCCGCGCAAGTGGGCGGCATCGGCATTGCCCCGGG
-CGCCAACCTGTCGGATTCCGTGGCCATGTTCGAAGCCACCCACGGCACCGCGCCGAAGTACGCGGGCAAG
-GACTACGTGAACCCCGGTTCCGAAATCCTGTCGGCCGAAATGATGCTGCGCCACATGGGCTGGACCGAGG
-CCGCCGACCTGATCATCGCCAGCATGGAGAAATCCATCCTGTCCAAGAAGGTCACCTATGACTTCGCCCG
-TCTGCTCGAAGGCGCCACCCAGGTGTCGTGCTCGGGCTTCGGTCAGGTCATGATCGACAATATGTAA
->lcl|BX640418.1_cds_CAE42692.1_2372 [gene=pepA] [locus_tag=BP2421] [db_xref=GOA:Q7VW48,InterPro:IPR000819,InterPro:IPR008283,InterPro:IPR011356,InterPro:IPR023042] [protein=cytosol aminopeptidase] [protein_id=CAE42692.1] [location=131847..133346] [gbkey=CDS]
-ATGGAATTTAGCACACAGACCACTGCCTCCCTGCATCAGATCAAGACTGCGGCCCTGGCCGTCGGCGTCT
-TCGCCGACGGCGTGCTCAGCGCCGCCGCCGAAGTCATCGACCGCGCCAGCCACGGTGCCGTGGCCGCCGT
-GGTGAAAAGCGAGTTCCGCGGCCGCACCGGCAGCACGCTGGTGCTGCGCAGCCTGGCCGGCGTCAGCGCC
-CAGCGCGTGGTGCTGGTGGGCCTGGGCAAGCAGGCCGAATACAACGCCCGCGCGCACGCCAGCGCCGAAC
-AGGCGTTCGCCGCGGCGTGCGTCGCGGCCCAGGTGGGCGAAGGCGTGTCGACCCTGGCCGGCGTGGCCAT
-CGAGGGCGTGCCGGTGCGCGCCCGCGCGCGCAGCGCCGCCATCGCCGCGGGCGCGGCGGCCTACCATTAC
-GATGCGACGTTCGGCAAGGCCAATCGCGACGCCCGCCCCAGGTTGAAGAAAATCGTCCAGGTGGTCGACC
-GCGCGGCCTCCGCGCAGGCGCAGCTGGGCCTGCGCGAAGGCGCGGCCATCGCCCACGGCATGGAATTGAC
-CCGCACGCTGGGCAACCTGCCCGGCAACGTGTGCACGCCGGCCTATCTCGGCAATACCGCCAAGAAACTG
-GCGCGCGAATTCAAGAGCCTCAAGGTCGAGGTGCTCGAACGCAAGCAGGTCGAGGCGCTGGGCATGGGCT
-CGTTCCTCTCGGTCGCGCGCGGCTCGGAAGAACCGCTGCGCTTCATCGTGCTGCGCCATGCCGGCAAGCC
-CGCCAAGAAGGACAAGGCCGGCCCGGTCGTCCTGGTGGGCAAGGGCATCACCTTCGATGCTGGCGGCATC
-TCGCTCAAGCCGGCCGCCACGATGGACGAAATGAAGTACGACATGTGCGGCGCGGCCAGCGTGCTGGGCA
-CGTTCCGCGCCCTGGCCGAGCTGGAGCTGCCGCTGGATGTGGTGGGCCTGATCGCGGCGTGCGAGAACCT
-GCCCAGCGGCAAGGCCAACAAGCCCGGCGACGTGGTCACCAGCATGTCGGGCCAGACCATCGAGATCCTC
-AACACCGACGCCGAAGGCCGCCTGGTGCTGTGCGATGCCCTGACCTACGCCGAGCGCTTCAAGCCCGCGG
-CCGTGATCGACATCGCCACGTTGACCGGCGCCTGCGTGGTAGCCCTGGGCAACGTCAATAGCGGCCTGTT
-CTCCAAGGACGACGCGCTGGCCGACGCGCTGCTGGCCGCCAGCCGCCAGTCGCTCGACCCGGCCTGGCGC
-CTGCCGCTGGACGATGCCTACCAGGACCAGCTCAAGTCCAACTTCGCCGACATCGCCAACATCGGCGGCC
-CCCCGGCCGGCGCGGTCACGGCGGCCTGCTTCCTGTCGCGCTTCACCAAGGCTTATCCGTGGGCGCACCT
-GGACATCGCCGGCACGGCCTGGCGCGGCGGCAAGGACAAGGGCGCCACCGGCCGGCCGGTGCCGCTGCTG
-ATGCAGTACCTGCTGGACCAGGCAGGCTGA
->lcl|BX640420.1_cds_CAE43408.1_3088 [gene=pgm] [locus_tag=BP3141] [db_xref=GOA:Q7VUF5,InterPro:IPR005841,InterPro:IPR005843,InterPro:IPR005844,InterPro:IPR005845,InterPro:IPR005846,InterPro:IPR016055,InterPro:IPR016066,UniProtKB/TrEMBL:Q7VUF5] [protein=phosphoglucomutase] [protein_id=CAE43408.1] [location=217601..218983] [gbkey=CDS]
-GTGGCGCACCCCTTTCCCGCATCGGTCTACAAGGCGTACGACATCCGTGGCTCGGTTCCCGACCAGCTCG
-ACCCGGTATTCGCCCGGGCGCTGGGCCGCGCCCTGGCCGCCAGCGCCCGCGCGCAGGGCATCGGCGCCCT
-GGTGGTCGGCCGCGACGGCCGCCTGAGCAGCCCCGACCTGGCCGGCGCGCTGCAGGAAGGCATCATGGAA
-GGCGGCGTGGACACCCTGGACATCGGCCAGGTGCCCACGCCGCTGGTCTATTTCGCGGCGCACATCCAGG
-GCACGGGCTCGGGCGTGGCGGTCACCGGCAGCCACAACCCGCCGCAGTACAACGGCTTCAAGATGATGAT
-GGGCGGCCAGGCCCTGTACGGCCCGGCCGTGCAGGCGCTGCGCCCGGCCATGCTGGCGCCGGCTGCGGCG
-CCGGGCACCTGGGGCGAACGCCGCCAGCTCGATGTCGTCCCCGCCTATATCGAGCGCATCGTGTCCGACG
-TGAAGCTGGCGCGCCCCATGAAGATCGCCGTCGACTGCGGCAATGGCGTGGCCGGCGCCCTGGCGCCGCA
-ACTGTTCCGCGCGCTGGGTTGCGAAGTGGACGAGCTCTATTGCGAGGTCGACGGCACGTTTCCCAACCAC
-CATCCCGACCCGGCCGAACCGCGCAACCTGCAGGACCTGATCGCCCATGTCACCAGCACCGACTGCGAGC
-TGGGCCTGGCCTTCGACGGCGACGGCGACCGCCTCGGCGTGGTGACCAAGTCCGGCCAGATCATCTGGCC
-CGACCGCCAGCTGATCCTGTTCGCCCGCGACGTGCTGGCCCGCTGTCCCGGCGCGACCATCATCTATGAC
-GTCAAGTGCAGCCAGCACGTGGGCGTGGCCATCGAGCAAAGCGGCGGCGTGCCGCTGATGTGGCAGACTG
-GCCATTCGCTGGTGAAGGCCAAGCTGGCCGAGACCGGCGCGCCGCTGGCCGGCGAGATGAGCGGCCATAT
-CTTCTTCAAGGAGCGCTGGTACGGCTTCGACGACGGCCTGTACACCGGCGCCCGCCTGCTGGAAATCGTC
-TCCCGCGAAACCGATGCGTCGCGCCCGCTGGAGGCCCTGCCGCAGGCGCTGTCGACCCCCGAGCTCAAGC
-TGGAGATGGCCGAGGGCGAGCCGCATGCGCTGATCGCCGCCCTGCAGCAGCAGGGCGAGTTCGCCAGCGC
-CAGCCGGCTGGTTACGATAGACGGCGTGCGCGCGGAATACCCGGACGGCTTCGGGCTGGCGCGCGCCTCC
-AATACCACCCCCGTCGTCGTGCTGCGCTTCGAAGCGGAGACCGAGCCGGGCCTGGCCCGCATCCAGCAGG
-AATTCCGCCAGCAGCTGCTGCGGCTGGCTCCGCAAGCCAAACTGCCCTTCTGA
->lcl|BX640416.1_cds_CAE42081.1_1761 [gene=tyrB] [locus_tag=BP1795] [db_xref=GOA:Q7VXH5,InterPro:IPR000796,InterPro:IPR004838,InterPro:IPR004839,InterPro:IPR015421,InterPro:IPR015424,UniProtKB/TrEMBL:Q7VXH5] [protein=aromatic-amino-acid aminotransferase] [protein_id=CAE42081.1] [location=complement(151299..152501)] [gbkey=CDS]
-ATGAGCACTCTTTTCGCTTCCGTCGAACTCGCGCCGCGCGACCCCATTCTTGGCCTGAACGAACAGTACA
-ACGCCGATACCCGTCCCGGCAAAGTGAACCTGGGCGTGGGCGTGTACTACGACGACGAAGGCCGCATCCC
-GCTGCTTCAGGCCGTGCGCAAGGCCGAGGTGGCCCGCATCGAAGCCGCCGCCGCCCGCGGCTATCTGCCG
-ATCGAAGGCATCGCGGGGTACAACAAGGGTGCGCAGGCGCTGCTGCTGGGCGCCGACTCGCCGCTGGCCG
-CCGAAGGCCGCGTGCTGACCGCGCAGGCCCTGGGCGGCACCGGCGCGCTGAAGATCGGCGCCGACTTCCT
-GCGCCAGCTGCTGCCGCAGTCCAAGGTCCTCATCAGCGACCCCAGCTGGGAAAACCACCGCGCCCTGTTC
-GAGCGCGCCGGCTTCCCGGTCGAGACCTACGCTTATTACGATGCCGCCACCCATGGCCTGAACTTCGAAG
-CCATGCTGGCCGCCCTGCAGGCCGCGCCCGAACAGACCATCGTGGTGCTGCACGCCTGCTGCCACAACCC
-GACCGGCGTCGATCCCACGCCGCAACAGTGGGAACAGATCGCCGCCGTGGTCAAGGCGCGCAACCTGGTG
-CCGTTCCTCGACATCGCCTACCAGGGCTTCGGCGAAGGCCTGGAGCAGGACGCCGCCGTGGTGCGCATGT
-TCGCCGCGCTCGACCTGACCATGTTCATCAGCTCGTCGTTCTCCAAGTCCTTCTCGCTGTATGGCGAGCG
-GGTCGGGGCCCTGACCGTGGTGGCCGGCAGCAAGGACGAGGCCGCCCGCGTGCTCAGCCAGCTCAAGCGC
-GTGATCCGCACCAACTACTCCAACCCGCCCACCCACGGCGGCACCGTGGTGTCCACGGTCCTGAACACAC
-CCGAGCTGTTCGCGCTCTGGGAAAATGAACTGGCCGGCATGCGCGACCGCATCCGCCTGATGCGCAAGGA
-GCTGGTCGAGAAGATCAAGACCCAGGGCGTGGCGCAGGACTTCAGCTTCGTGCTGGCGCAGCGCGGCATG
-TTCTCGTACTCGGGCCTGACCGCCGCCCAGGTCGATCGCCTGCGCGAAGAGCACGGCATCTACGCGGTCT
-CCAGCGGCCGCATCTGCGTGGCCGCGCTCAACAGCCGCAACATCGACGCGGTCGCGGCCGGCATCGCCGC
-GGTGCTGAAGTAG
--- a/test-data/tohama_I_minimized_features_typed.csv
+++ b/test-data/tohama_I_minimized_features_typed.csv
@@ -1,2 +0,0 @@
-id,st,clonal-complex,adk,fumC,glyA,icd,pepA,pgm,tyrB
-lcl|BX640419.1_cds_CAE43044.1_2724-lcl|BX640411.1_cds_CAE40628.1_248-lcl|BX640420.1_cds_CAE43224.1_2904-lcl|BX640418.1_cds_CAE42760.1_2440-lcl|BX640418.1_cds_CAE42692.1_2372-lcl|BX640420.1_cds_CAE43408.1_3088-lcl|BX640416.1_cds_CAE42081.1_1761,1,ST-2 complex,1,1,1,1,1,1,1
Author	SHA1	Message	Date
Harrison Deng	3836c84abd	Added Galaxy repo as a submodule Some checks failed autoBIGS.galaxy/pipeline/head There was a failure building this commit Details	2025-03-06 09:43:26 -06:00
Harrison Deng	bb26222ddd	Added personal development channel to planemo serve and lint VSCode tasks Some checks failed autoBIGS.galaxy/pipeline/head There was a failure building this commit Details	2025-02-27 21:12:24 +00:00
Harrison Deng	a622c5c52c	Moved actual tool definition to submodule Some checks failed autoBIGS.galaxy/pipeline/head There was a failure building this commit Details	2025-02-26 21:08:12 +00:00
Harrison Deng	61f44f8338	Add auto-updated-tools-iuc repo Some checks failed autoBIGS.galaxy/pipeline/head There was a failure building this commit Details	2025-02-25 23:09:27 +00:00
Harrison Deng	411a169079	Updated description Some checks are pending autoBIGS.galaxy/pipeline/head Build queued... Details	2025-02-25 16:50:27 +00:00
Harrison Deng	6a3e692d82	Updated .shed.yml owner to iuc	2025-02-25 16:46:24 +00:00
Harrison Deng	dcf28c8051	Added more help information and changed file input to use multiple instead of repeat. Some checks are pending autoBIGS.galaxy/pipeline/head Build queued... Details	2025-02-25 16:44:32 +00:00
Harrison Deng	ddb98514fb	Changed to whitespaces Some checks failed autoBIGS.galaxy/pipeline/head There was a failure building this commit Details	2025-02-25 15:16:37 +00:00