Added optional parameter to change timeout

Instead of generating a tuple comprised of the one sequence ID repeated

.devcontainer/Dockerfile

@@ -0,0 +1,11 @@
+FROM mcr.microsoft.com/devcontainers/anaconda:1-3
+
+# Copy environment.yml (if found) to a temp location so we update the environment. Also
+# copy "noop.txt" so the COPY instruction does not fail if no environment.yml exists.
+COPY environment.yml* .devcontainer/noop.txt /tmp/conda-tmp/
+RUN if [ -f "/tmp/conda-tmp/environment.yml" ]; then umask 0002 && /opt/conda/bin/conda env update -n base -f /tmp/conda-tmp/environment.yml; fi \
+    && rm -rf /tmp/conda-tmp
+
+# [Optional] Uncomment this section to install additional OS packages.
+# RUN apt-get update && export DEBIAN_FRONTEND=noninteractive \
+#     && apt-get -y install --no-install-recommends <your-package-list-here>

.devcontainer/devcontainer.json

@@ -1,9 +1,11 @@
 // For format details, see https://aka.ms/devcontainer.json. For config options, see the
-// README at: https://github.com/devcontainers/templates/tree/main/src/python
+// README at: https://github.com/devcontainers/templates/tree/main/src/anaconda
 {
-	"name": "Python 3",
+	"name": "Anaconda (Python 3)",
-	// Or use a Dockerfile or Docker Compose file. More info: https://containers.dev/guide/dockerfile
+	"build": { 
-	"image": "mcr.microsoft.com/devcontainers/python:1-3.12-bullseye",
+		"context": "..",
+		"dockerfile": "Dockerfile"
+	}
 
 	// Features to add to the dev container. More info: https://containers.dev/features.
 	// "features": {},
@@ -12,14 +14,7 @@
 	// "forwardPorts": [],
 
 	// Use 'postCreateCommand' to run commands after the container is created.
-	"postCreateCommand": "pip3 install --user -r requirements.txt",
+	// "postCreateCommand": "python --version",
-	"customizations": {
-		"vscode": {
-			"extensions": [
-				"mechatroner.rainbow-csv"
-			]
-		}
-	}
 
 	// Configure tool-specific properties.
 	// "customizations": {},

.devcontainer/noop.txt

@@ -0,0 +1,3 @@
+This file copied into the container along with environment.yml* from the parent
+folder. This file is included to prevents the Dockerfile COPY instruction from 
+failing if no environment.yml is found.

.gitignore

@@ -1,6 +1,6 @@
 # File created using '.gitignore Generator' for Visual Studio Code: https://bit.ly/vscode-gig
-# Created by https://www.toptal.com/developers/gitignore/api/visualstudiocode,svelte,python,linux,node
+# Created by https://www.toptal.com/developers/gitignore/api/visualstudiocode,linux,python
-# Edit at https://www.toptal.com/developers/gitignore?templates=visualstudiocode,svelte,python,linux,node
+# Edit at https://www.toptal.com/developers/gitignore?templates=visualstudiocode,linux,python
 
 ### Linux ###
 *~
@@ -17,146 +17,6 @@
 # .nfs files are created when an open file is removed but is still being accessed
 .nfs*
 
-### Node ###
-# Logs
-logs
-*.log
-npm-debug.log*
-yarn-debug.log*
-yarn-error.log*
-lerna-debug.log*
-.pnpm-debug.log*
-
-# Diagnostic reports (https://nodejs.org/api/report.html)
-report.[0-9]*.[0-9]*.[0-9]*.[0-9]*.json
-
-# Runtime data
-pids
-*.pid
-*.seed
-*.pid.lock
-
-# Directory for instrumented libs generated by jscoverage/JSCover
-lib-cov
-
-# Coverage directory used by tools like istanbul
-coverage
-*.lcov
-
-# nyc test coverage
-.nyc_output
-
-# Grunt intermediate storage (https://gruntjs.com/creating-plugins#storing-task-files)
-.grunt
-
-# Bower dependency directory (https://bower.io/)
-bower_components
-
-# node-waf configuration
-.lock-wscript
-
-# Compiled binary addons (https://nodejs.org/api/addons.html)
-build/Release
-
-# Dependency directories
-node_modules/
-jspm_packages/
-
-# Snowpack dependency directory (https://snowpack.dev/)
-web_modules/
-
-# TypeScript cache
-*.tsbuildinfo
-
-# Optional npm cache directory
-.npm
-
-# Optional eslint cache
-.eslintcache
-
-# Optional stylelint cache
-.stylelintcache
-
-# Microbundle cache
-.rpt2_cache/
-.rts2_cache_cjs/
-.rts2_cache_es/
-.rts2_cache_umd/
-
-# Optional REPL history
-.node_repl_history
-
-# Output of 'npm pack'
-*.tgz
-
-# Yarn Integrity file
-.yarn-integrity
-
-# dotenv environment variable files
-.env
-.env.development.local
-.env.test.local
-.env.production.local
-.env.local
-
-# parcel-bundler cache (https://parceljs.org/)
-.cache
-.parcel-cache
-
-# Next.js build output
-.next
-out
-
-# Nuxt.js build / generate output
-.nuxt
-dist
-
-# Gatsby files
-.cache/
-# Comment in the public line in if your project uses Gatsby and not Next.js
-# https://nextjs.org/blog/next-9-1#public-directory-support
-# public
-
-# vuepress build output
-.vuepress/dist
-
-# vuepress v2.x temp and cache directory
-.temp
-
-# Docusaurus cache and generated files
-.docusaurus
-
-# Serverless directories
-.serverless/
-
-# FuseBox cache
-.fusebox/
-
-# DynamoDB Local files
-.dynamodb/
-
-# TernJS port file
-.tern-port
-
-# Stores VSCode versions used for testing VSCode extensions
-.vscode-test
-
-# yarn v2
-.yarn/cache
-.yarn/unplugged
-.yarn/build-state.yml
-.yarn/install-state.gz
-.pnp.*
-
-### Node Patch ###
-# Serverless Webpack directories
-.webpack/
-
-# Optional stylelint cache
-
-# SvelteKit build / generate output
-.svelte-kit
-
 ### Python ###
 # Byte-compiled / optimized / DLL files
 __pycache__/
@@ -202,6 +62,7 @@ htmlcov/
 .nox/
 .coverage
 .coverage.*
+.cache
 nosetests.xml
 coverage.xml
 *.cover
@@ -215,6 +76,7 @@ cover/
 *.pot
 
 # Django stuff:
+*.log
 local_settings.py
 db.sqlite3
 db.sqlite3-journal
@@ -278,6 +140,7 @@ celerybeat.pid
 *.sage.py
 
 # Environments
+.env
 .venv
 env/
 venv/
@@ -326,13 +189,6 @@ poetry.toml
 # LSP config files
 pyrightconfig.json
 
-### Svelte ###
-# gitignore template for the SvelteKit, frontend web component framework
-# website: https://kit.svelte.dev/
-
-.svelte-kit/
-package
-
 ### VisualStudioCode ###
 .vscode/*
 !.vscode/settings.json
@@ -352,9 +208,8 @@ package
 .history
 .ionide
 
-# End of https://www.toptal.com/developers/gitignore/api/visualstudiocode,svelte,python,linux,node
+# End of https://www.toptal.com/developers/gitignore/api/visualstudiocode,linux,python
 
 # Custom rules (everything added below won't be overriden by 'Generate .gitignore File' if you use 'Update' option)
 
-output
+conda-bld
-*.private.*

.vscode/extensions.json

@@ -0,0 +1,6 @@
+{
+    "recommendations": [
+        "piotrpalarz.vscode-gitignore-generator",
+        "gruntfuggly.todo-tree"
+    ]
+}

.vscode/launch.json

@@ -1,25 +0,0 @@
-{
-    // Use IntelliSense to learn about possible attributes.
-    // Hover to view descriptions of existing attributes.
-    // For more information, visit: https://go.microsoft.com/fwlink/?linkid=830387
-    "version": "0.2.0",
-    "configurations": [
-        
-        {
-            "name": "autobigs info -lschema pubmlst_bordetella_seqdef",
-            "type": "debugpy",
-            "request": "launch",
-            "program": "${workspaceFolder}/src/autobigs/cli/program.py",
-            "console": "integratedTerminal",
-            "args": [
-                "info",
-                "-lschemas",
-                "pubmlst_bordetella_seqdef"
-            ],
-            "cwd": "${workspaceFolder}/src",
-            "env": {
-                "PYTHONPATH": "${workspaceFolder}/src"
-            }
-        }
-    ]
-}

Jenkinsfile

@@ -2,14 +2,14 @@ pipeline {
     agent {
         kubernetes {
             cloud 'rsys-devel'
-            defaultContainer 'pip'
+            defaultContainer 'miniforge3'
-            inheritFrom 'pip'
+            inheritFrom 'miniforge'
         }
     }
     stages {
         stage("install") {
             steps {
-                sh 'python -m pip install -r requirements.txt'
+                sh 'conda env update -n base -f environment.yml'
             }
         }
         stage("unit tests") {
@@ -22,26 +22,36 @@ pipeline {
         stage("build") {
             steps {
                 sh "python -m build"
+                sh "grayskull pypi dist/*.tar.gz --maintainers 'Harrison Deng'"
+                sh "python scripts/patch_recipe.py"
+                sh 'conda build autobigs-engine -c bioconda --output-folder conda-bld --verify'
             }
         }
         stage("archive") {
             steps {
-                archiveArtifacts artifacts: 'dist/*.tar.gz, dist/*.whl', fingerprint: true, followSymlinks: false, onlyIfSuccessful: true
+                archiveArtifacts artifacts: 'dist/*.tar.gz, dist/*.whl, conda-bld/**/*.conda', fingerprint: true, followSymlinks: false, onlyIfSuccessful: true
             }
         }
         stage("publish") {
             parallel {
                 stage ("git.reslate.systems") {
+                    when {
+                        not {
+                            tag '*.*.*'
+                        }
+                    }
+
                     environment {
                         CREDS = credentials('username-password-rs-git')
                     }
                     steps {
-                        sh returnStatus: true, script: 'python -m twine upload --repository-url https://git.reslate.systems/api/packages/ydeng/pypi -u ${CREDS_USR} -p ${CREDS_PSW} --non-interactive --disable-progress-bar --verbose dist/*'
+                        sh 'python -m twine upload --repository-url https://git.reslate.systems/api/packages/ydeng/pypi -u ${CREDS_USR} -p ${CREDS_PSW} --non-interactive --disable-progress-bar --verbose dist/*'
+                        sh 'curl --user ${CREDS_USR}:${CREDS_PSW} --upload-file conda-bld/**/*.conda https://git.reslate.systems/api/packages/${CREDS_USR}/conda/$(basename conda-bld/**/*.conda)'
                     }
                 }
                 stage ("pypi.org") {
                     when {
-                        tag '*.*'
+                        tag '*.*.*'
                     }
                     environment {
                         TOKEN = credentials('pypi.org')

README.md

@@ -8,7 +8,7 @@ A python library implementing common BIGSdb MLST schemes and databases accesses
 Briefly, this library can:
 - Import multiple `FASTA` files
 - Fetch the available BIGSdb databases that is currently live and available
-- Fetch the available BIGSdb database schemas for a given MLST database
+- Fetch the available BIGSdb database schemes for a given MLST database
 - Retrieve exact/non-exact MLST allele variant IDs based off a sequence
 - Retrieve MLST sequence type IDs based off a sequence
 - Output all results to a single CSV

environment.yml

@@ -0,0 +1,16 @@
+name: ci
+channels:
+  - bioconda
+  - conda-forge
+dependencies:
+  - aiohttp==3.11.*
+  - biopython==1.85
+  - pytest
+  - pytest-asyncio
+  - python-build
+  - conda-build
+  - twine==6.0.1
+  - setuptools_scm
+  - pytest-cov
+  - grayskull
+  - curl

requirements.txt

@@ -1,8 +0,0 @@
-aiohttp[speedups]==3.11.*
-biopython==1.85
-pytest
-pytest-asyncio
-build
-twine
-setuptools_scm
-pytest-cov

scripts/patch_recipe.py

@@ -0,0 +1,103 @@
+#!/usr/bin/env python3
+
+import argparse
+from os import fdopen, path
+import os
+import re
+import shutil
+from sys import argv
+import tempfile
+
+INDENTATION = "  "
+GRAYSKULL_OUTPUT_PATH = "autoBIGS.engine"
+RUN_EXPORTED_VALUE = r'{{ pin_subpackage( name|lower|replace(".", "-"), max_pin="x.x") }}'
+LICENSE_SUFFIX = "-or-later"
+HOME_PAGE = "https://github.com/Syph-and-VPD-Lab/autoBIGS.engine"
+
+def _calc_indentation(line: str):
+    return len(re.findall(INDENTATION, line.split(line.strip())[0])) if line != "\n" else 0
+
+def read_grayskull_output():
+    original_recipe = path.abspath(GRAYSKULL_OUTPUT_PATH)
+    original_meta = path.join(original_recipe, "meta.yaml")
+    meta_file = open(original_meta)
+    lines = meta_file.readlines()
+    meta_file.close()
+    return lines
+
+def update_naming_scheme(lines):
+    modified_lines = []
+    for line in lines:
+        matches = re.finditer(r"\{\{\s*name\|lower()\s+\}\}", line)
+        modified_line = line
+        for match in matches:
+            modified_line = modified_line[:match.start(1)] + r'|replace(".", "-")' + modified_line[match.end(1):]
+        modified_lines.append(modified_line)
+    return modified_lines
+
+def inject_run_exports(lines: list[str]):
+    package_indent = False
+    modified_lines = []
+    for line in lines:
+        indentation_count = _calc_indentation(line)
+        if line == "build:\n" and indentation_count == 0:
+            package_indent = True
+            modified_lines.append(line)
+        elif package_indent and indentation_count == 0:
+            modified_lines.append(INDENTATION*1 + "run_exports:\n")
+            modified_lines.append(INDENTATION*2 + "- " + RUN_EXPORTED_VALUE + "\n")
+            package_indent = False
+        else:
+            modified_lines.append(line)
+    return modified_lines
+
+def suffix_license(lines: list[str]):
+    about_indent = False
+    modified_lines = []
+    for line in lines:
+        indentation_count = _calc_indentation(line)
+        if line == "about:\n" and indentation_count == 0:
+            about_indent = True
+            modified_lines.append(line)
+        elif about_indent and indentation_count == 1 and line.lstrip().startswith("license:"):
+            modified_lines.append(line.rstrip() + LICENSE_SUFFIX  + "\n")
+            about_indent = False
+        else:
+            modified_lines.append(line)
+    return modified_lines
+
+def inject_home_page(lines: list[str]):
+    about_indent = False
+    modified_lines = []
+    for line in lines:
+        indentation_count = _calc_indentation(line)
+        if line == "about:\n" and indentation_count == 0:
+            about_indent = True
+            modified_lines.append(line)
+        elif about_indent and indentation_count == 0:
+            modified_lines.append(INDENTATION + "home: " + HOME_PAGE + "\n")
+            about_indent = False
+        else:
+            modified_lines.append(line)
+    return modified_lines
+
+def write_to_original(lines: list[str]):
+    original_recipe = path.abspath(GRAYSKULL_OUTPUT_PATH)
+    original_meta = path.join(original_recipe, "meta.yaml")
+    with open(original_meta, "w") as file:
+        file.writelines(lines)
+
+def rename_recipe_dir():
+    new_recipe_name = path.abspath(path.join(GRAYSKULL_OUTPUT_PATH.replace(".", "-").lower()))
+    shutil.rmtree(new_recipe_name, ignore_errors=True)
+    os.replace(path.abspath(GRAYSKULL_OUTPUT_PATH), new_recipe_name)
+
+if __name__ == "__main__":
+    original_grayskull_out = read_grayskull_output()
+    modified_recipe_meta = None
+    modified_recipe_meta = update_naming_scheme(original_grayskull_out)
+    modified_recipe_meta = inject_run_exports(modified_recipe_meta)
+    modified_recipe_meta = suffix_license(modified_recipe_meta)
+    modified_recipe_meta = inject_home_page(modified_recipe_meta)
+    write_to_original(modified_recipe_meta)
+    rename_recipe_dir()

src/autobigs/engine/analysis/bigsdb.py

@@ -7,9 +7,9 @@ from os import path
 import os
 import shutil
 import tempfile
-from typing import Any, AsyncGenerator, AsyncIterable, Iterable, Mapping, Sequence, Set, Union
+from typing import Any, AsyncGenerator, AsyncIterable, Coroutine, Iterable, Mapping, Sequence, Set, Union
 
-from aiohttp import ClientSession, ClientTimeout
+from aiohttp import ClientOSError, ClientSession, ClientTimeout, ServerDisconnectedError
 
 from autobigs.engine.reading import read_fasta
 from autobigs.engine.structures.alignment import PairwiseAlignment
@@ -22,15 +22,15 @@ from Bio.Align import PairwiseAligner
 class BIGSdbMLSTProfiler(AbstractAsyncContextManager):
 
     @abstractmethod
-    def determine_mlst_allele_variants(self, query_sequence_strings: Iterable[str]) -> AsyncGenerator[Allele, Any]:
+    def determine_mlst_allele_variants(self, query_sequence_strings: Union[Iterable[Union[NamedString, str]], Union[NamedString, str]]) -> AsyncGenerator[Union[Allele, tuple[str, Allele]], Any]:
         pass
 
     @abstractmethod
-    async def determine_mlst_st(self, alleles: Union[AsyncIterable[Allele], Iterable[Allele]]) -> MLSTProfile:
+    async def determine_mlst_st(self, alleles: Union[AsyncIterable[Union[Allele, tuple[str, Allele]]], Iterable[Union[Allele, tuple[str, Allele]]]]) -> Union[MLSTProfile, NamedMLSTProfile]:
         pass
 
     @abstractmethod
-    async def profile_string(self, query_sequence_strings: Iterable[str]) -> MLSTProfile:
+    async def profile_string(self, query_sequence_strings: Iterable[Union[NamedString, str]]) -> Union[NamedMLSTProfile, MLSTProfile]:
         pass
 
     @abstractmethod
@@ -43,98 +43,157 @@ class BIGSdbMLSTProfiler(AbstractAsyncContextManager):
 
 class RemoteBIGSdbMLSTProfiler(BIGSdbMLSTProfiler):
 
-    def __init__(self, database_api: str, database_name: str, schema_id: int):
+    def __init__(self, database_api: str, database_name: str, scheme_id: int, retry_requests: int = 5, timeout: int = 600):
+        self._timeout = timeout
+        self._retry_limit = retry_requests
         self._database_name = database_name
-        self._schema_id = schema_id
+        self._scheme_id = scheme_id
-        self._base_url = f"{database_api}/db/{self._database_name}/schemes/{self._schema_id}/"
+        self._base_url = f"{database_api}/db/{self._database_name}/schemes/{self._scheme_id}/"
-        self._http_client = ClientSession(self._base_url, timeout=ClientTimeout(60))
+        self._http_client = ClientSession(self._base_url, timeout=ClientTimeout(timeout))
 
     async def __aenter__(self):
         return self
 
-    async def determine_mlst_allele_variants(self, query_sequence_strings: Union[Iterable[str], str]) -> AsyncGenerator[Allele, Any]:
+    async def determine_mlst_allele_variants(self, query_sequence_strings: Union[Iterable[Union[NamedString, str]], Union[NamedString, str]]) -> AsyncGenerator[Union[Allele, tuple[str, Allele]], Any]:
         # See https://bigsdb.pasteur.fr/api/db/pubmlst_bordetella_seqdef/schemes
         uri_path = "sequence"
-        if isinstance(query_sequence_strings, str):
+        if isinstance(query_sequence_strings, str) or isinstance(query_sequence_strings, NamedString):
             query_sequence_strings = [query_sequence_strings]
+        
         for sequence_string in query_sequence_strings:
-            async with self._http_client.post(uri_path, json={
+            attempts = 0
-                "sequence": sequence_string,
+            success = False
-                "partial_matches": True
+            last_error = None
-            }) as response:
+            while not success and attempts < self._retry_limit:
-                sequence_response: dict = await response.json()
+                attempts += 1
+                request = self._http_client.post(uri_path, json={
+                    "sequence": sequence_string if isinstance(sequence_string, str) else sequence_string.sequence,
+                    "partial_matches": True
+                })
+                try:
+                    async with request as response:
+                        sequence_response: dict = await response.json()
 
-                if "exact_matches" in sequence_response:
+                        if "exact_matches" in sequence_response:
-                    # loci -> list of alleles with id and loci
+                            # loci -> list of alleles with id and loci
-                    exact_matches: dict[str, Sequence[dict[str, str]]] = sequence_response["exact_matches"]  
+                            exact_matches: dict[str, Sequence[dict[str, str]]] = sequence_response["exact_matches"]  
-                    for allele_loci, alleles in exact_matches.items():
+                            for allele_loci, alleles in exact_matches.items():
-                        for allele in alleles:
+                                for allele in alleles:
-                            alelle_id = allele["allele_id"]
+                                    alelle_id = allele["allele_id"]
-                            yield Allele(allele_locus=allele_loci, allele_variant=alelle_id, partial_match_profile=None)
+                                    result_allele = Allele(allele_locus=allele_loci, allele_variant=alelle_id, partial_match_profile=None)
-                elif "partial_matches" in sequence_response:
+                                    yield result_allele if isinstance(sequence_string, str) else (sequence_string.name, result_allele)
-                    partial_matches: dict[str, dict[str, Union[str, float, int]]] = sequence_response["partial_matches"] 
+                        elif "partial_matches" in sequence_response:
-                    for allele_loci, partial_match in partial_matches.items():
+                            partial_matches: dict[str, dict[str, Union[str, float, int]]] = sequence_response["partial_matches"] 
-                        if len(partial_match) <= 0:
+                            for allele_loci, partial_match in partial_matches.items():
-                            continue
+                                if len(partial_match) <= 0:
-                        partial_match_profile = AlignmentStats(
+                                    continue
-                            percent_identity=float(partial_match["identity"]),
+                                partial_match_profile = AlignmentStats(
-                            mismatches=int(partial_match["mismatches"]),
+                                    percent_identity=float(partial_match["identity"]),
-                            gaps=int(partial_match["gaps"]),
+                                    mismatches=int(partial_match["mismatches"]),
-                            match_metric=int(partial_match["bitscore"])
+                                    gaps=int(partial_match["gaps"]),
-                        )
+                                    match_metric=int(partial_match["bitscore"])
-                        yield Allele(
+                                )
-                            allele_locus=allele_loci,
+                                result_allele = Allele(
-                            allele_variant=str(partial_match["allele"]),
+                                    allele_locus=allele_loci,
-                            partial_match_profile=partial_match_profile
+                                    allele_variant=str(partial_match["allele"]),
-                        )
+                                    partial_match_profile=partial_match_profile
+                                )
+                                yield result_allele if isinstance(sequence_string, str) else (sequence_string.name, result_allele)
+                        else:
+                            raise NoBIGSdbMatchesException(self._database_name, self._scheme_id, sequence_string.name if isinstance(sequence_string, NamedString) else None)
+                except (ConnectionError, ServerDisconnectedError, ClientOSError) as e: # Errors we will retry
+                    last_error = e
+                    success = False
+                    await asyncio.sleep(5) # In case the connection issue is due to rate issues
                 else:
-                    raise NoBIGSdbMatchesException(self._database_name, self._schema_id)
+                    success = True
+            if not success and last_error is not None:
+                try:
+                    raise last_error
+                except (ConnectionError, ServerDisconnectedError, ClientOSError) as e: # Non-fatal errors
+                    yield Allele("error", "error", None)
 
-    async def determine_mlst_st(self, alleles: Union[AsyncIterable[Allele], Iterable[Allele]]) -> MLSTProfile:
+    async def determine_mlst_st(self, alleles: Union[AsyncIterable[Union[Allele, tuple[str, Allele]]], Iterable[Union[Allele, tuple[str, Allele]]]]) -> Union[MLSTProfile, NamedMLSTProfile]:
         uri_path = "designations"
         allele_request_dict: dict[str, list[dict[str, str]]] = defaultdict(list)
+        names_list = []
+        def insert_allele_to_request_dict(allele: Union[Allele, tuple[str, Allele]]):
+            if isinstance(allele, Allele):
+                allele_val = allele
+            else:
+                allele_val = allele[1]
+                names_list.append(allele[0])
+            allele_request_dict[allele_val.allele_locus].append({"allele": str(allele_val.allele_variant)})
+
         if isinstance(alleles, AsyncIterable):
             async for allele in alleles:
-                allele_request_dict[allele.allele_locus].append({"allele": str(allele.allele_variant)})
+                insert_allele_to_request_dict(allele)
         else:
             for allele in alleles:
-                allele_request_dict[allele.allele_locus].append({"allele": str(allele.allele_variant)})
+                insert_allele_to_request_dict(allele)
         request_json = {
             "designations": allele_request_dict
         }
-        async with self._http_client.post(uri_path, json=request_json) as response:
-            response_json: dict = await response.json()
-            allele_set: Set[Allele] = set()
-            response_json.setdefault("fields", dict())
-            schema_fields_returned: dict[str, str] = response_json["fields"]
-            schema_fields_returned.setdefault("ST", "unknown")
-            schema_fields_returned.setdefault("clonal_complex", "unknown")
-            schema_exact_matches: dict = response_json["exact_matches"]
-            for exact_match_locus, exact_match_alleles in schema_exact_matches.items():
-                if len(exact_match_alleles) > 1:
-                    raise ValueError(f"Unexpected number of alleles returned for exact match (Expected 1, retrieved {len(exact_match_alleles)})")
-                allele_set.add(Allele(exact_match_locus, exact_match_alleles[0]["allele_id"], None))
-            if len(allele_set) == 0:
-                raise ValueError("Passed in no alleles.")
-            return MLSTProfile(allele_set, schema_fields_returned["ST"], schema_fields_returned["clonal_complex"])
 
-    async def profile_string(self, query_sequence_strings: Iterable[str]) -> MLSTProfile:
+        attempts = 0
+        success = False
+        last_error = None
+        while attempts < self._retry_limit and not success:
+            attempts += 1
+            try:
+                async with self._http_client.post(uri_path, json=request_json) as response:
+                    response_json: dict = await response.json()
+                    allele_set: Set[Allele] = set()
+                    response_json.setdefault("fields", dict())
+                    scheme_fields_returned: dict[str, str] = response_json["fields"]
+                    scheme_fields_returned.setdefault("ST", "unknown")
+                    scheme_fields_returned.setdefault("clonal_complex", "unknown")
+                    scheme_exact_matches: dict = response_json["exact_matches"]
+                    for exact_match_locus, exact_match_alleles in scheme_exact_matches.items():
+                        allele_set.add(Allele(exact_match_locus, exact_match_alleles[0]["allele_id"], None))
+                    if len(allele_set) == 0:
+                        raise ValueError("Passed in no alleles.")
+                    result_mlst_profile = MLSTProfile(allele_set, scheme_fields_returned["ST"], scheme_fields_returned["clonal_complex"])
+                    if len(names_list) > 0:
+                        result_mlst_profile = NamedMLSTProfile(str(tuple(names_list)) if len(set(names_list)) > 1 else names_list[0], result_mlst_profile)
+                    return result_mlst_profile
+            except (ConnectionError, ServerDisconnectedError, ClientOSError) as e:
+                last_error = e
+                success = False
+                await asyncio.sleep(5)
+            else:
+                success = True
+        try:
+            if last_error is not None:
+                raise last_error
+        except (ConnectionError, ServerDisconnectedError, ClientOSError) as e:
+                result_mlst_profile = NamedMLSTProfile((str(tuple(names_list)) if len(set(names_list)) > 1 else names_list[0]) + ":Error", None)
+        raise ValueError("Last error was not recorded.")
+
+                    
+    async def profile_string(self, query_sequence_strings: Iterable[Union[NamedString, str]]) -> Union[NamedMLSTProfile, MLSTProfile]:
         alleles = self.determine_mlst_allele_variants(query_sequence_strings)
         return await self.determine_mlst_st(alleles)
 
     async def profile_multiple_strings(self, query_named_string_groups: AsyncIterable[Iterable[NamedString]], stop_on_fail: bool = False) -> AsyncGenerator[NamedMLSTProfile, Any]:
+        tasks: list[Coroutine[Any, Any, Union[NamedMLSTProfile, MLSTProfile]]] = []
         async for named_strings in query_named_string_groups:
-            names: list[str] = list()
+            tasks.append(self.profile_string(named_strings))
-            sequences: list[str] = list()
+        for task in asyncio.as_completed(tasks):
-            for named_string in named_strings:
+            named_mlst_profile = await task
-                names.append(named_string.name)
-                sequences.append(named_string.sequence)
             try:
-                yield NamedMLSTProfile("-".join(names), (await self.profile_string(sequences)))
+                if isinstance(named_mlst_profile, NamedMLSTProfile):
+                    yield named_mlst_profile
+                else:
+                    raise TypeError("MLST profile is not named.")
             except NoBIGSdbMatchesException as e:
                 if stop_on_fail:
                     raise e
-                yield NamedMLSTProfile("-".join(names), None)
+                causal_name = e.get_causal_query_name()
+                if causal_name is None:
+                    raise ValueError("Missing query name despite requiring names.")
+                else:
+                    yield NamedMLSTProfile(causal_name, None)
 
     async def close(self):
         await self._http_client.close()
@@ -151,7 +210,7 @@ class BIGSdbIndex(AbstractAsyncContextManager):
     def __init__(self):
         self._http_client = ClientSession()
         self._known_seqdef_dbs_origin: Union[Mapping[str, str], None] = None
-        self._seqdefdb_schemas: dict[str, Union[Mapping[str, int], None]] = dict()
+        self._seqdefdb_schemes: dict[str, Union[Mapping[str, int], None]] = dict()
         super().__init__()
 
     async def __aenter__(self):
@@ -177,22 +236,32 @@ class BIGSdbIndex(AbstractAsyncContextManager):
             raise NoSuchBIGSdbDatabaseException(seqdef_db_name)
         return known_databases[seqdef_db_name]     
 
-    async def get_schemas_for_seqdefdb(self, seqdef_db_name: str, force: bool = False) -> Mapping[str, int]:
+    async def get_schemes_for_seqdefdb(self, seqdef_db_name: str, force: bool = False) -> Mapping[str, int]:
-        if seqdef_db_name in self._seqdefdb_schemas and not force:
+        if seqdef_db_name in self._seqdefdb_schemes and not force:
-            return self._seqdefdb_schemas[seqdef_db_name] # type: ignore since it's guaranteed to not be none by conditional
+            return self._seqdefdb_schemes[seqdef_db_name] # type: ignore since it's guaranteed to not be none by conditional
         uri_path = f"{await self.get_bigsdb_api_from_seqdefdb(seqdef_db_name)}/db/{seqdef_db_name}/schemes"
         async with self._http_client.get(uri_path) as response: 
             response_json = await response.json()
-            schema_descriptions: Mapping[str, int] = dict()
+            scheme_descriptions: Mapping[str, int] = dict()
             for scheme_definition in response_json["schemes"]:
                 scheme_id: int = int(str(scheme_definition["scheme"]).split("/")[-1])
                 scheme_desc: str = scheme_definition["description"]
-                schema_descriptions[scheme_desc] = scheme_id
+                scheme_descriptions[scheme_desc] = scheme_id
-            self._seqdefdb_schemas[seqdef_db_name] = schema_descriptions
+            self._seqdefdb_schemes[seqdef_db_name] = scheme_descriptions
-            return self._seqdefdb_schemas[seqdef_db_name] # type: ignore
+            return self._seqdefdb_schemes[seqdef_db_name] # type: ignore
 
-    async def build_profiler_from_seqdefdb(self, local: bool, dbseqdef_name: str, schema_id: int) -> BIGSdbMLSTProfiler:
+    async def build_profiler_from_seqdefdb(self, local: bool, dbseqdef_name: str, scheme_id: int) -> BIGSdbMLSTProfiler:
-        return get_BIGSdb_MLST_profiler(local, await self.get_bigsdb_api_from_seqdefdb(dbseqdef_name), dbseqdef_name, schema_id)
+        return get_BIGSdb_MLST_profiler(local, await self.get_bigsdb_api_from_seqdefdb(dbseqdef_name), dbseqdef_name, scheme_id)
+    
+    async def get_scheme_loci(self, dbseqdef_name: str, scheme_id: int) -> list[str]:
+        uri_path = f"{await self.get_bigsdb_api_from_seqdefdb(dbseqdef_name)}/db/{dbseqdef_name}/schemes/{scheme_id}"
+        async with self._http_client.get(uri_path) as response:
+            response_json = await response.json()
+            loci = response_json["loci"]
+            results = []
+            for locus in loci:
+                results.append(path.basename(locus))
+            return results
 
     async def close(self):
         await self._http_client.close()
@@ -200,7 +269,7 @@ class BIGSdbIndex(AbstractAsyncContextManager):
     async def __aexit__(self, exc_type, exc_value, traceback):
         await self.close()
 
-def get_BIGSdb_MLST_profiler(local: bool, database_api: str, database_name: str, schema_id: int):
+def get_BIGSdb_MLST_profiler(local: bool, database_api: str, database_name: str, scheme_id: int):
     if local:
         raise NotImplementedError()
-    return RemoteBIGSdbMLSTProfiler(database_api=database_api, database_name=database_name, schema_id=schema_id)
+    return RemoteBIGSdbMLSTProfiler(database_api=database_api, database_name=database_name, scheme_id=scheme_id)

src/autobigs/engine/exceptions/database.py

@@ -5,17 +5,21 @@ class BIGSDbDatabaseAPIException(Exception):
 
 
 class NoBIGSdbMatchesException(BIGSDbDatabaseAPIException):
-    def __init__(self, database_name: str, database_schema_id: int, *args):
+    def __init__(self, database_name: str, database_scheme_id: int, query_name: Union[None, str], *args):
-        super().__init__(f"No matches found with schema with ID {database_schema_id}  in the database \"{database_name}\".", *args)
+        self._query_name = query_name
+        super().__init__(f"No matches found with scheme with ID {database_scheme_id}  in the database \"{database_name}\".", *args)
+    
+    def get_causal_query_name(self) -> Union[str, None]:
+        return self._query_name
 
 class NoBIGSdbExactMatchesException(NoBIGSdbMatchesException):
-    def __init__(self, database_name: str, database_schema_id: int, *args):
+    def __init__(self, database_name: str, database_scheme_id: int, *args):
-        super().__init__(f"No exact match found with schema with ID {database_schema_id}  in the database \"{database_name}\".", *args)
+        super().__init__(f"No exact match found with scheme with ID {database_scheme_id}  in the database \"{database_name}\".", *args)
 
 class NoSuchBIGSdbDatabaseException(BIGSDbDatabaseAPIException):
     def __init__(self, database_name: str, *args):
         super().__init__(f"No database \"{database_name}\" found.", *args)
 
-class NoSuchBigSdbSchemaException(BIGSDbDatabaseAPIException):
+class NoSuchBigSdbschemeException(BIGSDbDatabaseAPIException):
-    def __init__(self, database_name: str, database_schema_id: int, *args):
+    def __init__(self, database_name: str, database_scheme_id: int, *args):
-        super().__init__(f"No schema with ID {database_schema_id}  in \"{database_name}\" found.", *args)
+        super().__init__(f"No scheme with ID {database_scheme_id}  in \"{database_name}\" found.", *args)

src/autobigs/engine/reading.py

@@ -1,5 +1,6 @@
 import asyncio
 from io import TextIOWrapper
+from os import path
 from typing import Any, AsyncGenerator, Iterable, Union
 from Bio import SeqIO
 
@@ -9,9 +10,12 @@ async def read_fasta(handle: Union[str, TextIOWrapper]) -> Iterable[NamedString]
     fasta_sequences = asyncio.to_thread(SeqIO.parse, handle=handle, format="fasta")
     results = []
     for fasta_sequence in await fasta_sequences:
-        results.append(NamedString(fasta_sequence.id, str(fasta_sequence.seq)))
+        results.append(NamedString("{0}:{1}".format(path.basename(handle.name if isinstance(handle, TextIOWrapper) else handle), fasta_sequence.id), str(fasta_sequence.seq)))
     return results
 
 async def read_multiple_fastas(handles: Iterable[Union[str, TextIOWrapper]]) -> AsyncGenerator[Iterable[NamedString], Any]:
+    tasks = []
     for handle in handles:
-        yield await read_fasta(handle)
+        tasks.append(read_fasta(handle))
+    for task in asyncio.as_completed(tasks):
+        yield await task

src/autobigs/engine/structures/genomics.py

@@ -25,7 +25,7 @@ class SangerTraceData(NamedString):
     analysis_proto_settings_name: str
     analysis_rpto_settings_ver: str
     analysis_proto_xml_data: str
-    analysis_proto_xml_schema_ver: str
+    analysis_proto_xml_scheme_ver: str
     sample_comment: Union[None, str]
     capillary_machine: bool
     container_identifier: str

src/autobigs/engine/writing.py

@@ -1,7 +1,7 @@
 from collections import defaultdict
 import csv
 from os import PathLike
-from typing import AsyncIterable, Collection, Mapping, Sequence, Union
+from typing import AsyncIterable, Collection, Iterable, Mapping, Sequence, Union
 
 from autobigs.engine.structures.mlst import Allele, MLSTProfile, NamedMLSTProfile
 
@@ -17,7 +17,7 @@ def alleles_to_text_map(alleles: Collection[Allele]) -> Mapping[str, Union[Seque
             result[locus] = tuple(result[locus]) # type: ignore
     return dict(result)
 
-async def write_mlst_profiles_as_csv(mlst_profiles_iterable: AsyncIterable[NamedMLSTProfile], handle: Union[str, bytes, PathLike[str], PathLike[bytes]]) -> Sequence[str]:
+async def write_mlst_profiles_as_csv(mlst_profiles_iterable: AsyncIterable[NamedMLSTProfile], handle: Union[str, bytes, PathLike[str], PathLike[bytes]], allele_names: Iterable[str]) -> Sequence[str]:
     failed = list()
     with open(handle, "w", newline='') as filehandle:
         header = None
@@ -30,7 +30,7 @@ async def write_mlst_profiles_as_csv(mlst_profiles_iterable: AsyncIterable[Named
                 continue
             allele_mapping = alleles_to_text_map(mlst_profile.alleles)
             if writer is None:
-                header = ["id", "st", "clonal-complex", *sorted(allele_mapping.keys())]
+                header = ["id", "st", "clonal-complex", *sorted(allele_names)]
                 writer = csv.DictWriter(filehandle, fieldnames=header)
                 writer.writeheader()
             row_dictionary = {

tests/autobigs/engine/analysis/test_bigsdb.py

@@ -7,7 +7,7 @@ import pytest
 from autobigs.engine.analysis import bigsdb
 from autobigs.engine.structures import mlst
 from autobigs.engine.structures.genomics import NamedString
-from autobigs.engine.structures.mlst import Allele, MLSTProfile
+from autobigs.engine.structures.mlst import Allele, MLSTProfile, NamedMLSTProfile
 from autobigs.engine.exceptions.database import NoBIGSdbExactMatchesException, NoBIGSdbMatchesException
 from autobigs.engine.analysis.bigsdb import BIGSdbIndex, BIGSdbMLSTProfiler, RemoteBIGSdbMLSTProfiler
 
@@ -71,14 +71,14 @@ hinfluenzae_2014_102_bad_profile = MLSTProfile((
     ), "unknown", "unknown")
 
 
-@pytest.mark.parametrize("local_db,database_api,database_name,schema_id,seq_path,feature_seqs_path,expected_profile,bad_profile", [
+@pytest.mark.parametrize("local_db,database_api,database_name,scheme_id,seq_path,feature_seqs_path,expected_profile,bad_profile", [
     (False, "https://bigsdb.pasteur.fr/api", "pubmlst_bordetella_seqdef", 3, "tohama_I_bpertussis.fasta", "tohama_I_bpertussis_features.fasta", bpertussis_tohamaI_profile, bpertussis_tohamaI_bad_profile),
     (False, "https://rest.pubmlst.org", "pubmlst_hinfluenzae_seqdef", 1, "2014-102_hinfluenza.fasta", "2014-102_hinfluenza_features.fasta", hinfluenzae_2014_102_profile, hinfluenzae_2014_102_bad_profile),
 ])
 class TestBIGSdbMLSTProfiler:
-    async def test_profiling_results_in_exact_matches_when_exact(self, local_db, database_api, database_name, schema_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
+    async def test_profiling_results_in_exact_matches_when_exact(self, local_db, database_api, database_name, scheme_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
         sequence = get_first_sequence_from_fasta(seq_path)
-        async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, schema_id) as dummy_profiler:
+        async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, scheme_id) as dummy_profiler:
             expected_alleles = mlst.alleles_to_mapping(expected_profile.alleles)
             targets_left = set(mlst.alleles_to_mapping(expected_profile.alleles).keys())
             async for exact_match in dummy_profiler.determine_mlst_allele_variants(query_sequence_strings=[sequence]):
@@ -89,10 +89,10 @@ class TestBIGSdbMLSTProfiler:
 
             assert len(targets_left) == 0
 
-    async def test_sequence_profiling_non_exact_returns_non_exact(self, local_db, database_api, database_name, schema_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
+    async def test_sequence_profiling_non_exact_returns_non_exact(self, local_db, database_api, database_name, scheme_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
         target_sequences = get_multiple_sequences_from_fasta(feature_seqs_path)
         mlst_targets = {x.lower() for x in mlst.alleles_to_mapping(expected_profile.alleles).keys()}
-        async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, schema_id) as profiler:
+        async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, scheme_id) as profiler:
             for target_sequence in target_sequences:
                 match = re.fullmatch(r".*\[gene=([\w\d]+)\].*", target_sequence.description)
                 if match is None:
@@ -102,42 +102,54 @@ class TestBIGSdbMLSTProfiler:
                     continue
                 scrambled = gene_scrambler(str(target_sequence.seq), 0.125)
                 async for partial_match in profiler.determine_mlst_allele_variants([scrambled]):
+                    assert isinstance(partial_match, Allele)
                     assert partial_match.partial_match_profile is not None
                     mlst_targets.remove(gene)
 
             assert len(mlst_targets) == 0
 
-    async def test_profiling_results_in_correct_mlst_st(self, local_db, database_api, database_name, schema_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
+    async def test_profiling_results_in_correct_mlst_st(self, local_db, database_api, database_name, scheme_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
-        async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, schema_id) as dummy_profiler:
+        async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, scheme_id) as dummy_profiler:
             mlst_st_data = await dummy_profiler.determine_mlst_st(expected_profile.alleles)
             assert mlst_st_data is not None
             assert isinstance(mlst_st_data, MLSTProfile)
             assert mlst_st_data.clonal_complex == expected_profile.clonal_complex
             assert mlst_st_data.sequence_type == expected_profile.sequence_type
 
-    async def test_profiling_non_exact_results_in_list_of_mlsts(self, local_db, database_api, database_name, schema_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
+    async def test_profiling_non_exact_results_in_list_of_mlsts(self, local_db, database_api, database_name, scheme_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
         dummy_alleles = bad_profile.alleles
-        async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, schema_id) as dummy_profiler:
+        async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, scheme_id) as dummy_profiler:
             mlst_profile = await dummy_profiler.determine_mlst_st(dummy_alleles)
+            assert isinstance(mlst_profile, MLSTProfile)
             assert mlst_profile.clonal_complex == "unknown"
             assert mlst_profile.sequence_type == "unknown"
 
 
-    async def test_bigsdb_profile_multiple_strings_same_string_twice(self, local_db, database_api, database_name, schema_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
+    async def test_bigsdb_profile_multiple_strings_same_string_twice(self, local_db, database_api, database_name, scheme_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
         sequence = get_first_sequence_from_fasta(seq_path)
         dummy_sequences = [[NamedString("seq1", sequence)], [NamedString("seq2", sequence)]]
-        async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, schema_id) as dummy_profiler:
+        async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, scheme_id) as dummy_profiler:
             async for named_profile in dummy_profiler.profile_multiple_strings(generate_async_iterable(dummy_sequences)):
                 name, profile = named_profile.name, named_profile.mlst_profile
-                assert profile is not None
                 assert isinstance(profile, MLSTProfile)
                 assert profile.clonal_complex == expected_profile.clonal_complex
                 assert profile.sequence_type == expected_profile.sequence_type
 
-    async def test_bigsdb_profile_multiple_strings_exactmatch_fail_second_no_stop(self, local_db, database_api, database_name, schema_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
+    async def test_bigsdb_profile_named_string_no_repeat_name(self, local_db, database_api, database_name, scheme_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
+        sequence = get_first_sequence_from_fasta(seq_path)
+        async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, scheme_id) as dummy_profiler:
+            named_profile = await dummy_profiler.profile_string([NamedString("BX470248.1", sequence)])
+            assert isinstance(named_profile, NamedMLSTProfile)
+            name, profile = named_profile.name, named_profile.mlst_profile
+            assert isinstance(profile, MLSTProfile)
+            assert profile.clonal_complex == expected_profile.clonal_complex
+            assert profile.sequence_type == expected_profile.sequence_type
+            assert name == "BX470248.1"
+
+    async def test_bigsdb_profile_multiple_strings_exactmatch_fail_second_no_stop(self, local_db, database_api, database_name, scheme_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
         valid_seq = get_first_sequence_from_fasta(seq_path)
         dummy_sequences = [[NamedString("seq1", valid_seq)], [NamedString("should_fail", gene_scrambler(valid_seq, 0.3))], [NamedString("seq3", valid_seq)]]
-        async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, schema_id) as dummy_profiler:
+        async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, scheme_id) as dummy_profiler:
             async for name_profile in dummy_profiler.profile_multiple_strings(generate_async_iterable(dummy_sequences), True):
                 name, profile = name_profile.name, name_profile.mlst_profile
 
@@ -151,11 +163,11 @@ class TestBIGSdbMLSTProfiler:
                     assert profile.clonal_complex == expected_profile.clonal_complex
                     assert profile.sequence_type == expected_profile.sequence_type
 
-    async def test_bigsdb_profile_multiple_strings_nonexact_second_no_stop(self, local_db, database_api, database_name, schema_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
+    async def test_bigsdb_profile_multiple_strings_nonexact_second_no_stop(self, local_db, database_api, database_name, scheme_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
         valid_seq = get_first_sequence_from_fasta(seq_path)
         dummy_sequences = [[NamedString("seq1", valid_seq)], [NamedString("should_fail", gene_scrambler(valid_seq, 0.3))], [NamedString("seq3", valid_seq)]]
 
-        async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, schema_id) as dummy_profiler:
+        async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, scheme_id) as dummy_profiler:
             async for named_profile in dummy_profiler.profile_multiple_strings(generate_async_iterable(dummy_sequences), False):
                 name, profile = named_profile.name, named_profile.mlst_profile
                 
@@ -183,12 +195,12 @@ class TestBIGSdbIndex:
         async with BIGSdbIndex() as bigsdb_index:
             assert (await bigsdb_index.get_bigsdb_api_from_seqdefdb("pubmlst_bordetella_seqdef")) == "https://bigsdb.pasteur.fr/api"
 
-    async def test_bigsdb_index_get_schemas_for_bordetella(self):
+    async def test_bigsdb_index_get_schemes_for_bordetella(self):
         async with BIGSdbIndex() as index:
-            schemas = await index.get_schemas_for_seqdefdb(seqdef_db_name="pubmlst_bordetella_seqdef")
+            schemes = await index.get_schemes_for_seqdefdb(seqdef_db_name="pubmlst_bordetella_seqdef")
-            assert len(schemas.keys()) > 0
+            assert len(schemes.keys()) > 0
-            assert "MLST" in schemas
+            assert "MLST" in schemes
-            assert isinstance(schemas["MLST"], int)
+            assert isinstance(schemes["MLST"], int)
 
     async def test_bigsdb_index_get_databases_has_only_seqdef(self):
         async with BIGSdbIndex() as index:
@@ -207,5 +219,15 @@ class TestBIGSdbIndex:
             async with await bigsdb_index.build_profiler_from_seqdefdb(local, "pubmlst_bordetella_seqdef", 3) as profiler:
                 assert isinstance(profiler, BIGSdbMLSTProfiler)
                 profile = await profiler.profile_string(sequence)
+                assert isinstance(profile, MLSTProfile)
                 assert profile.clonal_complex == "ST-2 complex"
                 assert profile.sequence_type == "1"
+
+
+    @pytest.mark.parametrize(["bigsdb_name", "scheme_id", "expected"], [
+        ("pubmlst_bordetella_seqdef", 3, ["adk", "fumC", "glyA", "tyrB", "icd", "pepA", "pgm"])
+    ])
+    async def test_bigsdb_index_fetches_loci_names(self, bigsdb_name, scheme_id, expected):
+        async with BIGSdbIndex() as bigsdb_index:
+            loci = await bigsdb_index.get_scheme_loci(bigsdb_name, scheme_id)
+            assert set(loci) == set(expected)

tests/autobigs/engine/test_reading.py

@@ -4,4 +4,9 @@ from autobigs.engine.reading import read_fasta
 async def test_fasta_reader_not_none():
     named_strings = await read_fasta("tests/resources/tohama_I_bpertussis.fasta")
     for named_string in named_strings:
-        assert named_string.name == "BX470248.1"
+        assert named_string.name is not None
+
+async def test_fasta_reader_name_contains_file_and_id():
+    named_strings = await read_fasta("tests/resources/tohama_I_bpertussis.fasta")
+    for named_string in named_strings:
+        assert named_string.name == "tohama_I_bpertussis.fasta:BX470248.1"

tests/autobigs/engine/test_writing.py

@@ -27,15 +27,28 @@ async def test_column_order_is_same_as_expected_file(dummy_alphabet_mlst_profile
     dummy_profiles = [dummy_alphabet_mlst_profile]
     with tempfile.TemporaryDirectory() as temp_dir:
         output_path = path.join(temp_dir, "out.csv")
-        await write_mlst_profiles_as_csv(iterable_to_asynciterable(dummy_profiles), output_path)
+        await write_mlst_profiles_as_csv(iterable_to_asynciterable(dummy_profiles), output_path, ["A", "D", "B", "C"])
         with open(output_path) as csv_handle:
             csv_reader = reader(csv_handle)
             lines = list(csv_reader)
-            target_columns = lines[4:]
+            target_columns = lines[0][3:]
             assert target_columns == sorted(target_columns)
 
+async def test_csv_writing_sample_name_not_repeated_when_single_sequence(dummy_alphabet_mlst_profile):
+    dummy_profiles = [dummy_alphabet_mlst_profile]
+    with tempfile.TemporaryDirectory() as temp_dir:
+        output_path = path.join(temp_dir, "out.csv")
+        await write_mlst_profiles_as_csv(iterable_to_asynciterable(dummy_profiles), output_path, ["A", "D", "B", "C"])
+        with open(output_path) as csv_handle:
+            csv_reader = reader(csv_handle)
+            lines = list(csv_reader)
+            sample_name = lines[1][0]
+            assert sample_name == "name"
+
+
 async def test_alleles_to_text_map_mapping_is_correct(dummy_alphabet_mlst_profile: NamedMLSTProfile):
-    mapping = alleles_to_text_map(dummy_alphabet_mlst_profile.mlst_profile.alleles) # type: ignore
+    assert dummy_alphabet_mlst_profile.mlst_profile is not None
+    mapping = alleles_to_text_map(dummy_alphabet_mlst_profile.mlst_profile.alleles)
     expected_mapping = {
         "A": "1",
         "B": "1",
@@ -45,3 +58,13 @@ async def test_alleles_to_text_map_mapping_is_correct(dummy_alphabet_mlst_profil
     for allele_name, allele_ids in mapping.items():
         assert allele_name in expected_mapping
         assert allele_ids == expected_mapping[allele_name]
+
+async def test_csv_writing_includes_asterisk_for_non_exact(dummy_alphabet_mlst_profile: NamedMLSTProfile):
+    dummy_profiles = [dummy_alphabet_mlst_profile]
+    with tempfile.TemporaryDirectory() as temp_dir:
+        output_path = path.join(temp_dir, "out.csv")
+        await write_mlst_profiles_as_csv(iterable_to_asynciterable(dummy_profiles), output_path, ["A", "D", "B", "C"])
+        with open(output_path) as csv_handle:
+            csv_reader = reader(csv_handle)
+            lines = list(csv_reader)
+            assert '*' in lines[1][5]

tests/resources/B3913_bpertussis_minimized_features.fasta

@@ -0,0 +1,133 @@
+>lcl|CP011447.1_gene_2762 [gene=adk] [locus_tag=B3913_2762] [location=2916440..2917096] [gbkey=Gene]
+ATGCGTCTCATTCTGCTCGGACCGCCCGGAGCCGGCAAAGGCACCCAAGCCGCCTTTCTCACCCAACACT
+ACGGCATCCCGCAGATATCCACCGGTGACATGCTGCGCGCCGCCGTCAAGGCCGGCACGCCGCTGGGCCT
+GGAAGCCAAGAAGGTCATGGACGCGGGCGGCCTGGTCTCGGACGACCTGATCATCGGCCTGGTGCGCGAT
+CGCCTGACCCAGCCCGATTGCGCCAACGGCTACCTGTTCGACGGTTTCCCGCGCACCATCCCGCAGGCCG
+ACGCGCTCAAGAGCGCCGGCATCGCGCTGGATTACGTGGTCGAGATCGAAGTGCCGGAAAGCGACATCAT
+CGAACGCATGAGCGAACGCCGCGTGCACCCGGCCAGCGGCCGCAGCTACCACGTACGCTTCAATCCGCCC
+AAGGCCGAAGGCGTGGACGACGTCACGGGCGAACCGCTGGTGCAGCGCGACGACGACCGCGAGGAAACCG
+TGCGCCATCGTCTCAACGTCTACCAGAACCAGACCCGCCCGCTGGTCGACTACTACTCGTCCTGGGCCCA
+GTCCGATGCCGCCGCGGCGCCCAAGTACCGCAAGATCTCCGGCGTCGGCTCGGTCGACGAAATCAAGAGC
+CGCCTGTCGCAGGCTCTGCAGAGCTAA
+>lcl|CP011447.1_gene_253 [gene=fumC] [locus_tag=B3913_0253] [location=257438..258829] [gbkey=Gene]
+ATGAAAACCCGCACCGAAAAAGACACTTTCGGCCCGATCGAGGTGCCCGAGCAGCACCTGTGGGGCGCGC
+AGACCCAGCGCTCGCTGCATTTCTTCGCGATCTCGACCGAGAAGATGCCGGTGCCGCTGGTCGCCGCCAT
+GGCACGCCTGAAGCGCGCCGCCGCCAAGGTCAACGCCGAGCTGGGCGAGCTGGATCCGCAGGTCGCAGAC
+GCCATCATGCGGGCCGCCGATGAGGTGATCGCCGGCAAGTGGCCCGACGAGTTTCCGCTGTCGGTCTGGC
+AGACCGGCTCGGGCACGCAGAGCAACATGAACATGAACGAGGTGCTGGCCAACCGCGCCTCCGAGCTGCT
+GGGCGGCGAGCGCGGCGAAGGCCGCAAGGTGCACCCCAACGACCACGTGAACCGGGGCCAGTCGTCCAAC
+GATACCTTTCCGACCGCCATGCACGTGGCCGCCGCGGTCGAGGTCGAGCACCGCGTGCTGCCCGCCCTGA
+AGGCGTTGCGCGGCACGCTGGCCGCCAAGAGCGCGGCGTTCTACGACATCGTCAAGATCGGTCGCACCCA
+TTTGCAGGACGCCACCCCGTTGACGCTGGGCCAGGAGATCTCCGGCTACGTGGCGCAGCTGGACCTGGCC
+GAGCAGCAGATCCGCGCGACGCTGGCCGGCCTGCACCAGCTGGCCATCGGCGGCACGGCGGTGGGCACCG
+GCCTGAACGCGCATCCGCAGTTCAGCGCCAAGGTATCGGCCGAACTGGCCCATGACACGGGCAGCGCGTT
+CGTGTCGGCGCCCAACAAGTTCCAGGCGCTGGCTTCGCACGAGGCGCTGCTGTTCGCGCACGGCGCCTTG
+AAGACGCTGGCCGCCGGCCTGATGAAGATCGCCAACGATGTGCGCTGGCTGGCCAGCGGCCCGCGCTCGG
+GGCTGGGCGAAATCAGCATTCCCGAGAACGAGCCGGGCAGCTCCATCATGCCGGGCAAGGTCAACCCGAC
+CCAGTGCGAAGCCGTCACGATGCTGGCCGCGCAGGTCATGGGCAACGACGTGGCCATCAATGTCGGCGGG
+GCCAGCGGCAACTTCGAGCTGAACGTCTTCAAGCCGCTGGTGATCCACAATTTCCTGCAGTCGGTGCGCC
+TGCTGGCCGACGGCATGGTCAGCTTCGACAAGCACTGCGCGGCCGGCATCGAGCCCAACCGCGAGCGCAT
+CACCGAGCTGGTCGAGCGTTCGCTGATGCTGGTGACTGCGCTCAACCCGCACATCGGCTACGACAAGGCC
+GCGCAGATCGCCAAGAAGGCGCACAAGGAAAACCTGTCGCTGAAAGAGGCGGCGCTGGCGCTGGGGCACC
+TGACCGAGGCGCAGTTCGCCGAGTGGGTGGTGCCGGGCGACATGACCAACGCGCGCCGCTAG
+>lcl|CP011447.1_gene_2963 [gene=glyA] [locus_tag=B3913_2963] [location=complement(3129365..3130612)] [gbkey=Gene]
+ATGTTCAACCGCAACCTGACCCTCGACCAGGTGGATCCCGACGTCTGGGCCGCCATCCAGAAAGAAGACG
+TACGCCAGGAACAGCACATCGAGCTGATCGCGTCCGAGAACTACGCCAGCCCCGCCGTGATGCAGGCCCA
+GGGCACGCAACTGACCAACAAGTATGCGGAAGGCTACCCGGGCAAGCGCTACTACGGCGGTTGCGAGTAC
+GTCGACGTGGTCGAGCAGCTGGCCATCGACCGCCTGAAGCAGATTTTCGGCGCCGAGGCCGCCAACGTGC
+AGCCGAACTCCGGCTCGCAGGCCAACCAGGGCGTGTACATGGCGGTGCTCAAGCCGGGCGATACCGTGCT
+GGGCATGAGCCTGGCCGAAGGCGGTCACCTGACGCACGGCGCGTCGGTCAACGCCTCGGGCAAGCTGTAC
+AACTTCGTGCCCTACGGCCTGGACGCCGACGAGGTGCTGGACTACGCCCAGGTCGAGCGGCTGACCAAGG
+AACACAAGCCCAAGCTGATCGTGGCCGGCGCCTCCGCGTACGCGCTGCACATCGACTTCGAGCGCATGGC
+GCGCATCGCCCACGACAACGGCGCGCTGTTCATGGTGGACATCGCCCACTATGCCGGCCTGGTGGCCGGC
+GGCGCCTATCCCAACCCGGTGCCGCACGCCGATTTCGTCACCTCCACCACGCACAAGTCGCTGCGCGGCC
+CGCGCGGCGGCGTCATCATGATGAAGGCCGAGTTCGAGAAGGCCGTCAATTCGGCCATCTTCCCGGGCAT
+CCAGGGCGGTCCGCTGATGCACGTCATCGCGGCCAAGGCCGTGGCCTTCAAGGAAGCGCTGTCGCCCGAG
+TTCCAGGATTACGCCCAGCAGGTCGTCAAGAACGCCAAGGTGCTGGCCGATACGCTGGTCAAGCGCGGCC
+TGCGCATCGTGTCGGGCAGGACCGAAAGCCACGTCATGCTGGTGGACCTGCGTCCCAAGGGCATTACCGG
+CAAGGAAGCGGAAGCGGTGCTGGGCCAGGCCCACATCACGGTCAACAAGAACGCCATTCCCAACGACCCG
+GAAAAGCCCTTCGTGACCAGCGGCATCCGCCTGGGCACTCCGGCCATGACCACCCGCGGCTTCAAGGAGG
+CCGAGGCCGAGCTGACCGCCAACCTGATCGCCGACGTGCTGGACAATCCGCGCGACGAGGCGAACATCGC
+CGCGGTGCGCGCGCGGGTCAATGAACTGACCGCCCGCCTGCCCGTCTACGGCAACTGA
+>lcl|CP011447.1_gene_2473 [gene=icd] [locus_tag=B3913_2473] [location=complement(2605674..2606930)] [gbkey=Gene]
+ATGTCCTATCAACATATCAAGGTTCCCACTGGGGGCCAAAAAATCACGGTCAACGCCGATTACTCGCTGA
+ATGTGCCCGATCAGGTCATCATTCCGGTCATCGAGGGTGACGGTACGGGCGCCGACATCACGCCGGTGAT
+GATTAAGGTCGTCGACGCGGCCGTGCAGAAGGCCTATGCGGGCAAGCGCAAGATCCACTGGATGGAAGTC
+TACGCCGGCGAGAAGGCCACCAAGGTCTACGGCCCGGACGTCTGGCTGCCCGAGGAAACCCTCGACGCCG
+TCAAGGACTACGTGGTGTCGATCAAGGGTCCGCTGACCACGCCGGTCGGCGGCGGCATCCGTTCGCTGAA
+CGTGGCGCTGCGCCAGCAGCTGGACCTGTATGTCTGCCTGCGCCCGGTGCGCTACTTCAAGGGCGTGCCC
+TCGCCGGTGCGCGAGCCCGAGAAGACCGACATGGTCATCTTCCGCGAGAACTCGGAAGACATCTACGCGG
+GCATCGAGTACATGGCCGAGTCCGAGCAGGCCAAGGACCTGATCCAGTACCTGCAGACCAAGCTGGGCGT
+GACCAAGATCCGCTTCCCGAACACCTCGTCGATCGGCATCAAGCCGGTTTCGCGCGAAGGCACCGAGCGC
+CTGGTGCGCAAGGCGCTGCAGTACGCCATCGACAATGACCGCGCCTCGGTGACCCTGGTCCACAAGGGCA
+ACATCATGAAGTTCACGGAAGGCGGCTTCCGCGACTGGGGCTACGCCCTGGCCCAGAACGAGTTCGGCGC
+GCAGCCGATCGACGGCGGCCCGTGGTGCAAGTTCAAGAATCCCAAGACGGGTCGCGAGATCATCGTCAAG
+GATTCGATCGCCGACGCCTTCCTGCAGCAGATCCTGCTGCGTCCGGCCGAATACGACGTGATCGCCACGC
+TGAACCTGAACGGCGACTACATCTCCGACGCGCTGGCCGCGCAAGTGGGCGGCATCGGCATTGCCCCGGG
+CGCCAACCTGTCGGATTCCGTGGCCATGTTCGAAGCCACCCACGGCACCGCGCCGAAGTACGCGGGCAAG
+GACTACGTGAACCCCGGTTCCGAAATCCTGTCGGCCGAAATGATGCTGCGCCACATGGGCTGGACCGAGG
+CCGCCGACCTGATCATCGCCAGCATGGAGAAATCCATCCTGTCCAAGAAGGTCACCTATGACTTCGCCCG
+TCTGCTCGAAGGCGCCACCCAGGTGTCGTGCTCGGGCTTCGGTCAGGTCATGATCGACAATATGTAA
+>lcl|CP011447.1_gene_2403 [gene=pepA] [locus_tag=B3913_2403] [location=2531836..2533335] [gbkey=Gene]
+ATGGAATTTAGCACACAGACCACTGCCTCCCTGCATCAGATCAAGACTGCGGCCCTGGCCGTCGGCGTCT
+TCGCCGACGGCGTGCTCAGCGCCGCCGCCGAAGTCATCGACCGCGCCAGCCACGGTGCCGTGGCCGCCGT
+GGTGAAAAGCGAGTTCCGCGGCCGCACCGGCAGCACGCTGGTGCTGCGCAGCCTGGCCGGCGTCAGCGCC
+CAGCGCGTGGTGCTGGTGGGCCTGGGCAAGCAGGCCGAATACAACGCCCGCGCGCACGCCAGCGCCGAAC
+AGGCGTTCGCCGCGGCGTGCGTCGCGGCCCAGGTGGGCGAAGGCGTGTCGACCCTGGCCGGCGTGGCCAT
+CGAGGGCGTGCCGGTGCGCGCCCGCGCGCGCAGCGCCGCCATCGCCGCGGGCGCGGCGGCCTACCATTAC
+GATGCGACGTTCGGCAAGGCCAATCGCGACGCCCGCCCCAGGTTGAAGAAAATCGTCCAGGTGGTCGACC
+GCGCGGCCTCCGCGCAGGCGCAGCTGGGCCTGCGCGAAGGCGCGGCCATCGCCCACGGCATGGAATTGAC
+CCGCACGCTGGGCAACCTGCCCGGCAACGTGTGCACGCCGGCCTATCTCGGCAATACCGCCAAGAAACTG
+GCGCGCGAATTCAAGAGCCTCAAGGTCGAGGTGCTCGAACGCAAGCAGGTCGAGGCGCTGGGCATGGGCT
+CGTTCCTCTCGGTCGCGCGCGGCTCGGAAGAACCGCTGCGCTTCATCGTGCTGCGCCATGCCGGCAAGCC
+CGCCAAGAAGGACAAGGCCGGCCCGGTCGTCCTGGTGGGCAAGGGCATCACCTTCGATGCTGGCGGCATC
+TCGCTCAAGCCGGCCGCCACGATGGACGAAATGAAGTACGACATGTGCGGCGCGGCCAGCGTGCTGGGCA
+CGTTCCGCGCCCTGGCCGAGCTGGAGCTGCCGCTGGATGTGGTGGGCCTGATCGCGGCGTGCGAGAACCT
+GCCCAGCGGCAAGGCCAACAAGCCCGGCGACGTGGTCACCAGCATGTCGGGCCAGACCATCGAGATCCTC
+AACACCGACGCCGAAGGCCGCCTGGTGCTGTGCGATGCCCTGACCTACGCCGAGCGCTTCAAGCCCGCGG
+CCGTGATCGACATCGCCACGTTGACCGGCGCCTGCGTGGTAGCCCTGGGCAACGTCAATAGCGGCCTGTT
+CTCCAAGGACGACGCGCTGGCCGACGCGCTGCTGGCCGCCAGCCGCCAGTCGCTCGACCCGGCCTGGCGC
+CTGCCGCTGGACGATGCCTACCAGGACCAGCTCAAGTCCAACTTCGCCGACATCGCCAACATCGGCGGCC
+CCCCGGCCGGCGCGGTCACGGCGGCCTGCTTCCTGTCGCGCTTCACCAAGGCTTATCCGTGGGCGCACCT
+GGACATCGCCGGCACGGCCTGGCGCGGCGGCAAGGACAAGGGCGCCACCGGCCGGCCGGTGCCGCTGCTG
+ATGCAGTACCTGCTGGACCAGGCAGGCTGA
+>lcl|CP011447.1_gene_3165 [gene=pgm] [locus_tag=B3913_3165] [location=3355021..3356403] [gbkey=Gene]
+GTGGCGCACCCCTTTCCCGCATCGGTCTACAAGGCGTACGACATCCGTGGCTCGGTTCCCGACCAGCTCG
+ACCCGGTATTCGCCCGGGCGCTGGGCCGCGCCCTGGCCGCCAGCGCCCGCGCGCAGGGCATCGGCGCCCT
+GGTGGTCGGCCGCGACGGCCGCCTGAGCAGCCCCGACCTGGCCGGCGCGCTGCAGGAAGGCATCATGGAA
+GGCGGCGTGGACACCCTGGACATCGGCCAGGTGCCCACGCCGCTGGTCTATTTCGCGGCGCACATCCAGG
+GCACGGGCTCGGGCGTGGCGGTCACCGGCAGCCACAACCCGCCGCAGTACAACGGCTTCAAGATGATGAT
+GGGCGGCCAGGCCCTGTACGGCCCGGCCGTGCAGGCGCTGCGCCCGGCCATGCTGGCGCCGGCTGCGGCG
+CCGGGCACCTGGGGCGAACGCCGCCAGCTCGATGTCGTCCCCGCCTATATCGAGCGCATCGTGTCCGACG
+TGAAGCTGGCGCGCCCCATGAAGATCGCCGTCGACTGCGGCAATGGCGTGGCCGGCGCCCTGGCGCCGCA
+ACTGTTCCGCGCGCTGGGTTGCGAAGTGGACGAGCTCTATTGCGAGGTCGACGGCACGTTTCCCAACCAC
+CATCCCGACCCGGCCGAACCGCGCAACCTGCAGGACCTGATCGCCCATGTCACCAGCACCGACTGCGAGC
+TGGGCCTGGCCTTCGACGGCGACGGCGACCGCCTCGGCGTGGTGACCAAGTCCGGCCAGATCATCTGGCC
+CGACCGCCAGCTGATCCTGTTCGCCCGCGACGTGCTGGCCCGCTGTCCCGGCGCGACCATCATCTATGAC
+GTCAAGTGCAGCCAGCACGTGGGCGTGGCCATCGAGCAAAGCGGCGGCGTGCCGCTGATGTGGCAGACTG
+GCCATTCGCTGGTGAAGGCCAAGCTGGCCGAGACCGGCGCGCCGCTGGCCGGCGAGATGAGCGGCCATAT
+CTTCTTCAAGGAGCGCTGGTACGGCTTCGACGACGGCCTGTACACCGGCGCCCGCCTGCTGGAAATCGTC
+TCCCGCGAAACCGATGCGTCGCGCCCGCTGGAGGCCCTGCCGCAGGCGCTGTCGACCCCCGAGCTCAAGC
+TGGAGATGGCCGAGGGCGAGCCGCATGCGCTGATCGCCGCCCTGCAGCAGCAGGGCGAGTTCGCCAGCGC
+CAGCCGGCTGGTTACGATAGACGGCGTGCGCGCGGAATACCCGGACGGCTTCGGGCTGGCGCGCGCCTCC
+AATACCACCCCCGTCGTCGTGCTGCGCTTCGAAGCGGAGACCGAGCCGGGCCTGGCCCGCATCCAGCAGG
+AATTCCGCCAGCAGCTGCTGCGGCTGGCTCCGCAAGCCAAACTGCCCTTCTGA
+>lcl|CP011447.1_gene_2110 [gene=tyrB] [locus_tag=B3913_2110] [location=2214524..2215726] [gbkey=Gene]
+ATGAGCACTCTTTTCGCTTCCGTCGAACTCGCGCCGCGCGACCCCATTCTTGGCCTGAACGAACAGTACA
+ACGCCGATACCCGTCCCGGCAAAGTGAACCTGGGCGTGGGCGTGTACTACGACGACGAAGGCCGCATCCC
+GCTGCTTCAGGCCGTGCGCAAGGCCGAGGTGGCCCGCATCGAAGCCGCCGCCGCCCGCGGCTATCTGCCG
+ATCGAAGGCATCGCGGGGTACAACAAGGGTGCGCAGGCGCTGCTGCTGGGCGCCGACTCGCCGCTGGCCG
+CCGAAGGCCGCGTGCTGACCGCGCAGGCCCTGGGCGGCACCGGCGCGCTGAAGATCGGCGCCGACTTCCT
+GCGCCAGCTGCTGCCGCAGTCCAAGGTCCTCATCAGCGACCCCAGCTGGGAAAACCACCGCGCCCTGTTC
+GAGCGCGCCGGCTTCCCGGTCGAGACCTACGCTTATTACGATGCCGCCACCCATGGCCTGAACTTCGAAG
+CCATGCTGGCCGCCCTGCAGGCCGCGCCCGAACAGACCATCGTGGTGCTGCACGCCTGCTGCCACAACCC
+GACCGGCGTCGATCCCACGCCGCAACAGTGGGAACAGATCGCCGCCGTGGTCAAGGCGCGCAACCTGGTG
+CCGTTCCTCGACATCGCCTACCAGGGCTTCGGCGAAGGCCTGGAGCAGGACGCCGCCGTGGTGCGCATGT
+TCGCCGAGCTCGACCTGACCATGTTCATCAGCTCGTCGTTCTCCAAGTCCTTCTCGCTGTATGGCGAGCG
+GGTCGGGGCCCTGACCGTGGTGGCCGGCAGCAAGGACGAGGCCGCCCGCGTGCTCAGCCAGCTCAAGCGC
+GTGATCCGCACCAACTACTCCAACCCGCCCACCCACGGCGGCACCGTGGTGTCCACGGTCCTGAACACAC
+CCGAGCTGTTCGCGCTCTGGGAAAATGAACTGGCCGGCATGCGCGACCGCATCCGCCTGATGCGCAAGGA
+GCTGGTCGAGAAGATCAAGACCCAGGGCGTGGCGCAGGACTTCAGCTTCGTGCTGGCGCAGCGCGGCATG
+TTCTCGTACTCGGGCCTGACCGCCGCCCAGGTCGATCGCCTGCGCGAAGAGCACGGCATCTACGCGGTCT
+CCAGCGGCCGCATCTGCGTGGCCGCGCTCAACAGCCGCAACATCGACGCGGTCGCGGCCGGCATCGCCGC
+GGTGCTGAAGTAG

tests/resources/B3921_bpertussis_minimized_features.fasta

@@ -0,0 +1,133 @@
+>lcl|CP011448.1_cds_ALH77808.1_2459 [gene=adk] [locus_tag=B3921_2764] [protein=adenylate kinase] [protein_id=ALH77808.1] [location=2918521..2919177] [gbkey=CDS]
+ATGCGTCTCATTCTGCTCGGACCGCCCGGAGCCGGCAAAGGCACCCAAGCCGCCTTTCTCACCCAACACT
+ACGGCATCCCGCAGATATCCACCGGTGACATGCTGCGCGCCGCCGTCAAGGCCGGCACGCCGCTGGGCCT
+GGAAGCCAAGAAGGTCATGGACGCGGGCGGCCTGGTCTCGGACGACCTGATCATCGGCCTGGTGCGCGAT
+CGCCTGACCCAGCCCGATTGCGCCAACGGCTACCTGTTCGACGGTTTCCCGCGCACCATCCCGCAGGCCG
+ACGCGCTCAAGAGCGCCGGCATCGCGCTGGATTACGTGGTCGAGATCGAAGTGCCGGAAAGCGACATCAT
+CGAACGCATGAGCGAACGCCGCGTGCACCCGGCCAGCGGCCGCAGCTACCACGTACGCTTCAATCCGCCC
+AAGGCCGAAGGCGTGGACGACGTCACGGGCGAACCGCTGGTGCAGCGCGACGACGACCGCGAGGAAACCG
+TGCGCCATCGTCTCAACGTCTACCAGAACCAGACCCGCCCGCTGGTCGACTACTACTCGTCCTGGGCCCA
+GTCCGATGCCGCCGCGGCGCCCAAGTACCGCAAGATCTCCGGCGTCGGCTCGGTCGACGAAATCAAGAGC
+CGCCTGTCGCAGGCTCTGCAGAGCTAA
+>lcl|CP011448.1_cds_ALH75563.1_214 [gene=fumC] [locus_tag=B3921_0253] [protein=fumarate hydratase] [protein_id=ALH75563.1] [location=257428..258819] [gbkey=CDS]
+ATGAAAACCCGCACCGAAAAAGACACTTTCGGCCCGATCGAGGTGCCCGAGCAGCACCTGTGGGGCGCGC
+AGACCCAGCGCTCGCTGCATTTCTTCGCGATCTCGACCGAGAAGATGCCGGTGCCGCTGGTCGCCGCCAT
+GGCACGCCTGAAGCGCGCCGCCGCCAAGGTCAACGCCGAGCTGGGCGAGCTGGATCCGCAGGTCGCAGAC
+GCCATCATGCGGGCCGCCGATGAGGTGATCGCCGGCAAGTGGCCCGACGAGTTTCCGCTGTCGGTCTGGC
+AGACCGGCTCGGGCACGCAGAGCAACATGAACATGAACGAGGTGCTGGCCAACCGCGCCTCCGAGCTGCT
+GGGCGGCGAGCGCGGCGAAGGCCGCAAGGTGCACCCCAACGACCACGTGAACCGGGGCCAGTCGTCCAAC
+GATACCTTTCCGACCGCCATGCACGTGGCCGCCGCGGTCGAGGTCGAGCACCGCGTGCTGCCCGCCCTGA
+AGGCGTTGCGCGGCACGCTGGCCGCCAAGAGCGCGGCGTTCTACGACATCGTCAAGATCGGTCGCACCCA
+TTTGCAGGACGCCACCCCGTTGACGCTGGGCCAGGAGATCTCCGGCTACGTGGCGCAGCTGGACCTGGCC
+GAGCAGCAGATCCGCGCGACGCTGGCCGGCCTGCACCAGCTGGCCATCGGCGGCACGGCGGTGGGCACCG
+GCCTGAACGCGCATCCGCAGTTCAGCGCCAAGGTATCGGCCGAACTGGCCCATGACACGGGCAGCGCGTT
+CGTGTCGGCGCCCAACAAGTTCCAGGCGCTGGCTTCGCACGAGGCGCTGCTGTTCGCGCACGGCGCCTTG
+AAGACGCTGGCCGCCGGCCTGATGAAGATCGCCAACGATGTGCGCTGGCTGGCCAGCGGCCCGCGCTCGG
+GGCTGGGCGAAATCAGCATTCCCGAGAACGAGCCGGGCAGCTCCATCATGCCGGGCAAGGTCAACCCGAC
+CCAGTGCGAAGCCGTCACGATGCTGGCCGCGCAGGTCATGGGCAACGACGTGGCCATCAATGTCGGCGGG
+GCCAGCGGCAACTTCGAGCTGAACGTCTTCAAGCCGCTGGTGATCCACAATTTCCTGCAGTCGGTGCGCC
+TGCTGGCCGACGGCATGGTCAGCTTCGACAAGCACTGCGCGGCCGGCATCGAGCCCAACCGCGAGCGCAT
+CACCGAGCTGGTCGAGCGTTCGCTGATGCTGGTGACTGCGCTCAACCCGCACATCGGCTACGACAAGGCC
+GCGCAGATCGCCAAGAAGGCGCACAAGGAAAACCTGTCGCTGAAAGAGGCGGCGCTGGCGCTGGGGCACC
+TGACCGAGGCGCAGTTCGCCGAGTGGGTGGTGCCGGGCGACATGACCAACGCGCGCCGCTAG
+>lcl|CP011448.1_cds_ALH77981.1_2632 [gene=glyA] [locus_tag=B3921_2965] [protein=serine hydroxymethyltransferase] [protein_id=ALH77981.1] [location=complement(3131372..3132619)] [gbkey=CDS]
+ATGTTCAACCGCAACCTGACCCTCGACCAGGTGGATCCCGACGTCTGGGCCGCCATCCAGAAAGAAGACG
+TACGCCAGGAACAGCACATCGAGCTGATCGCGTCCGAGAACTACGCCAGCCCCGCCGTGATGCAGGCCCA
+GGGCACGCAACTGACCAACAAGTATGCGGAAGGCTACCCGGGCAAGCGCTACTACGGCGGTTGCGAGTAC
+GTCGACGTGGTCGAGCAGCTGGCCATCGACCGCCTGAAGCAGATTTTCGGCGCCGAGGCCGCCAACGTGC
+AGCCGAACTCCGGCTCGCAGGCCAACCAGGGCGTGTACATGGCGGTGCTCAAGCCGGGCGATACCGTGCT
+GGGCATGAGCCTGGCCGAAGGCGGTCACCTGACGCACGGCGCGTCGGTCAACGCCTCGGGCAAGCTGTAC
+AACTTCGTGCCCTACGGCCTGGACGCCGACGAGGTGCTGGACTACGCCCAGGTCGAGCGGCTGACCAAGG
+AACACAAGCCCAAGCTGATCGTGGCCGGCGCCTCCGCGTACGCGCTGCACATCGACTTCGAGCGCATGGC
+GCGCATCGCCCACGACAACGGCGCGCTGTTCATGGTGGACATCGCCCACTATGCCGGCCTGGTGGCCGGC
+GGCGCCTATCCCAACCCGGTGCCGCACGCCGATTTCGTCACCTCCACCACGCACAAGTCGCTGCGCGGCC
+CGCGCGGCGGCGTCATCATGATGAAGGCCGAGTTCGAGAAGGCCGTCAATTCGGCCATCTTCCCGGGCAT
+CCAGGGCGGTCCGCTGATGCACGTCATCGCGGCCAAGGCCGTGGCCTTCAAGGAAGCGCTGTCGCCCGAG
+TTCCAGGATTACGCCCAGCAGGTCGTCAAGAACGCCAAGGTGCTGGCCGATACGCTGGTCAAGCGCGGCC
+TGCGCATCGTGTCGGGCAGGACCGAAAGCCACGTCATGCTGGTGGACCTGCGTCCCAAGGGCATTACCGG
+CAAGGAAGCGGAAGCGGTGCTGGGCCAGGCCCACATCACGGTCAACAAGAACGCCATTCCCAACGACCCG
+GAAAAGCCCTTCGTGACCAGCGGCATCCGCCTGGGCACTCCGGCCATGACCACCCGCGGCTTCAAGGAGG
+CCGAGGCCGAGCTGACCGCCAACCTGATCGCCGACGTGCTGGACAATCCGCGCGACGAGGCGAACATCGC
+CGCGGTGCGCGCGCGGGTCAATGAACTGACCGCCCGCCTGCCCGTCTACGGCAACTGA
+>lcl|CP011448.1_cds_ALH77547.1_2198 [gene=icd] [locus_tag=B3921_2474] [protein=isocitrate dehydrogenase] [protein_id=ALH77547.1] [location=complement(2606706..2607962)] [gbkey=CDS]
+ATGTCCTATCAACATATCAAGGTTCCCACTGGGGGCCAAAAAATCACGGTCAACGCCGATTACTCGCTGA
+ATGTGCCCGATCAGGTCATCATTCCGGTCATCGAGGGTGACGGTACGGGCGCCGACATCACGCCGGTGAT
+GATTAAGGTCGTCGACGCGGCCGTGCAGAAGGCCTATGCGGGCAAGCGCAAGATCCACTGGATGGAAGTC
+TACGCCGGCGAGAAGGCCACCAAGGTCTACGGCCCGGACGTCTGGCTGCCCGAGGAAACCCTCGACGCCG
+TCAAGGACTACGTGGTGTCGATCAAGGGTCCGCTGACCACGCCGGTCGGCGGCGGCATCCGTTCGCTGAA
+CGTGGCGCTGCGCCAGCAGCTGGACCTGTATGTCTGCCTGCGCCCGGTGCGCTACTTCAAGGGCGTGCCC
+TCGCCGGTGCGCGAGCCCGAGAAGACCGACATGGTCATCTTCCGCGAGAACTCGGAAGACATCTACGCGG
+GCATCGAGTACATGGCCGAGTCCGAGCAGGCCAAGGACCTGATCCAGTACCTGCAGACCAAGCTGGGCGT
+GACCAAGATCCGCTTCCCGAACACCTCGTCGATCGGCATCAAGCCGGTTTCGCGCGAAGGCACCGAGCGC
+CTGGTGCGCAAGGCGCTGCAGTACGCCATCGACAATGACCGCGCCTCGGTGACCCTGGTCCACAAGGGCA
+ACATCATGAAGTTCACGGAAGGCGGCTTCCGCGACTGGGGCTACGCCCTGGCCCAGAACGAGTTCGGCGC
+GCAGCCGATCGACGGCGGCCCGTGGTGCAAGTTCAAGAATCCCAAGACGGGTCGCGAGATCATCGTCAAG
+GATTCGATCGCCGACGCCTTCCTGCAGCAGATCCTGCTGCGTCCGGCCGAATACGACGTGATCGCCACGC
+TGAACCTGAACGGCGACTACATCTCCGACGCGCTGGCCGCGCAAGTGGGCGGCATCGGCATTGCCCCGGG
+CGCCAACCTGTCGGATTCCGTGGCCATGTTCGAAGCCACCCACGGCACCGCGCCGAAGTACGCGGGCAAG
+GACTACGTGAACCCCGGTTCCGAAATCCTGTCGGCCGAAATGATGCTGCGCCACATGGGCTGGACCGAGG
+CCGCCGACCTGATCATCGCCAGCATGGAGAAATCCATCCTGTCCAAGAAGGTCACCTATGACTTCGCCCG
+TCTGCTCGAAGGCGCCACCCAGGTGTCGTGCTCGGGCTTCGGTCAGGTCATGATCGACAATATGTAA
+>lcl|CP011448.1_cds_ALH77480.1_2131 [gene=pepA] [locus_tag=B3921_2404] [protein=leucyl aminopeptidase] [protein_id=ALH77480.1] [location=2532868..2534367] [gbkey=CDS]
+ATGGAATTTAGCACACAGACCACTGCCTCCCTGCATCAGATCAAGACTGCGGCCCTGGCCGTCGGCGTCT
+TCGCCGACGGCGTGCTCAGCGCCGCCGCCGAAGTCATCGACCGCGCCAGCCACGGTGCCGTGGCCGCCGT
+GGTGAAAAGCGAGTTCCGCGGCCGCACCGGCAGCACGCTGGTGCTGCGCAGCCTGGCCGGCGTCAGCGCC
+CAGCGCGTGGTGCTGGTGGGCCTGGGCAAGCAGGCCGAATACAACGCCCGCGCGCACGCCAGCGCCGAAC
+AGGCGTTCGCCGCGGCGTGCGTCGCGGCCCAGGTGGGCGAAGGCGTGTCGACCCTGGCCGGCGTGGCCAT
+CGAGGGCGTGCCGGTGCGCGCCCGCGCGCGCAGCGCCGCCATCGCCGCGGGCGCGGCGGCCTACCATTAC
+GATGCGACGTTCGGCAAGGCCAATCGCGACGCCCGCCCCAGGTTGAAGAAAATCGTCCAGGTGGTCGACC
+GCGCGGCCTCCGCGCAGGCGCAGCTGGGCCTGCGCGAAGGCGCGGCCATCGCCCACGGCATGGAATTGAC
+CCGCACGCTGGGCAACCTGCCCGGCAACGTGTGCACGCCGGCCTATCTCGGCAATACCGCCAAGAAACTG
+GCGCGCGAATTCAAGAGCCTCAAGGTCGAGGTGCTCGAACGCAAGCAGGTCGAGGCGCTGGGCATGGGCT
+CGTTCCTCTCGGTCGCGCGCGGCTCGGAAGAACCGCTGCGCTTCATCGTGCTGCGCCATGCCGGCAAGCC
+CGCCAAGAAGGACAAGGCCGGCCCGGTCGTCCTGGTGGGCAAGGGCATCACCTTCGATGCTGGCGGCATC
+TCGCTCAAGCCGGCCGCCACGATGGACGAAATGAAGTACGACATGTGCGGCGCGGCCAGCGTGCTGGGCA
+CGTTCCGCGCCCTGGCCGAGCTGGAGCTGCCGCTGGATGTGGTGGGCCTGATCGCGGCGTGCGAGAACCT
+GCCCAGCGGCAAGGCCAACAAGCCCGGCGACGTGGTCACCAGCATGTCGGGCCAGACCATCGAGATCCTC
+AACACCGACGCCGAAGGCCGCCTGGTGCTGTGCGATGCCCTGACCTACGCCGAGCGCTTCAAGCCCGCGG
+CCGTGATCGACATCGCCACGTTGACCGGCGCCTGCGTGGTAGCCCTGGGCAACGTCAATAGCGGCCTGTT
+CTCCAAGGACGACGCGCTGGCCGACGCGCTGCTGGCCGCCAGCCGCCAGTCGCTCGACCCGGCCTGGCGC
+CTGCCGCTGGACGATGCCTACCAGGACCAGCTCAAGTCCAACTTCGCCGACATCGCCAACATCGGCGGCC
+CCCCGGCCGGCGCGGTCACGGCGGCCTGCTTCCTGTCGCGCTTCACCAAGGCTTATCCGTGGGCGCACCT
+GGACATCGCCGGCACGGCCTGGCGCGGCGGCAAGGACAAGGGCGCCACCGGCCGGCCGGTGCCGCTGCTG
+ATGCAGTACCTGCTGGACCAGGCAGGCTGA
+>lcl|CP011448.1_cds_ALH78163.1_2814 [gene=pgm] [locus_tag=B3921_3166] [protein=phosphoglucomutase] [protein_id=ALH78163.1] [location=3355979..3357361] [gbkey=CDS]
+GTGGCGCACCCCTTTCCCGCATCGGTCTACAAGGCGTACGACATCCGTGGCTCGGTTCCCGACCAGCTCG
+ACCCGGTATTCGCCCGGGCGCTGGGCCGCGCCCTGGCCGCCAGCGCCCGCGCGCAGGGCATCGGCGCCCT
+GGTGGTCGGCCGCGACGGCCGCCTGAGCAGCCCCGACCTGGCCGGCGCGCTGCAGGAAGGCATCATGGAA
+GGCGGCGTGGACACCCTGGACATCGGCCAGGTGCCCACGCCGCTGGTCTATTTCGCGGCGCACATCCAGG
+GCACGGGCTCGGGCGTGGCGGTCACCGGCAGCCACAACCCGCCGCAGTACAACGGCTTCAAGATGATGAT
+GGGCGGCCAGGCCCTGTACGGCCCGGCCGTGCAGGCGCTGCGCCCGGCCATGCTGGCGCCGGCTGCGGCG
+CCGGGCACCTGGGGCGAACGCCGCCAGCTCGATGTCGTCCCCGCCTATATCGAGCGCATCGTGTCCGACG
+TGAAGCTGGCGCGCCCCATGAAGATCGCCGTCGACTGCGGCAATGGCGTGGCCGGCGCCCTGGCGCCGCA
+ACTGTTCCGCGCGCTGGGTTGCGAAGTGGACGAGCTCTATTGCGAGGTCGACGGCACGTTTCCCAACCAC
+CATCCCGACCCGGCCGAACCGCGCAACCTGCAGGACCTGATCGCCCATGTCACCAGCACCGACTGCGAGC
+TGGGCCTGGCCTTCGACGGCGACGGCGACCGCCTCGGCGTGGTGACCAAGTCCGGCCAGATCATCTGGCC
+CGACCGCCAGCTGATCCTGTTCGCCCGCGACGTGCTGGCCCGCTGTCCCGGCGCGACCATCATCTATGAC
+GTCAAGTGCAGCCAGCACGTGGGCGTGGCCATCGAGCAAAGCGGCGGCGTGCCGCTGATGTGGCAGACTG
+GCCATTCGCTGGTGAAGGCCAAGCTGGCCGAGACCGGCGCGCCGCTGGCCGGCGAGATGAGCGGCCATAT
+CTTCTTCAAGGAGCGCTGGTACGGCTTCGACGACGGCCTGTACACCGGCGCCCGCCTGCTGGAAATCGTC
+TCCCGCGAAACCGATGCGTCGCGCCCGCTGGAGGCCCTGCCGCAGGCGCTGTCGACCCCCGAGCTCAAGC
+TGGAGATGGCCGAGGGCGAGCCGCATGCGCTGATCGCCGCCCTGCAGCAGCAGGGCGAGTTCGCCAGCGC
+CAGCCGGCTGGTTACGATAGACGGCGTGCGCGCGGAATACCCGGACGGCTTCGGGCTGGCGCGCGCCTCC
+AATACCACCCCCGTCGTCGTGCTGCGCTTCGAAGCGGAGACCGAGCCGGGCCTGGCCCGCATCCAGCAGG
+AATTCCGCCAGCAGCTGCTGCGGCTGGCTCCGCAAGCCAAACTGCCCTTCTGA
+>lcl|CP011448.1_cds_ALH77215.1_1866 [gene=tyrB] [locus_tag=B3921_2112] [protein=aromatic amino acid aminotransferase] [protein_id=ALH77215.1] [location=2216606..2217808] [gbkey=CDS]
+ATGAGCACTCTTTTCGCTTCCGTCGAACTCGCGCCGCGCGACCCCATTCTTGGCCTGAACGAACAGTACA
+ACGCCGATACCCGTCCCGGCAAAGTGAACCTGGGCGTGGGCGTGTACTACGACGACGAAGGCCGCATCCC
+GCTGCTTCAGGCCGTGCGCAAGGCCGAGGTGGCCCGCATCGAAGCCGCCGCCGCCCGCGGCTATCTGCCG
+ATCGAAGGCATCGCGGGGTACAACAAGGGTGCGCAGGCGCTGCTGCTGGGCGCCGACTCGCCGCTGGCCG
+CCGAAGGCCGCGTGCTGACCGCGCAGGCCCTGGGCGGCACCGGCGCGCTGAAGATCGGCGCCGACTTCCT
+GCGCCAGCTGCTGCCGCAGTCCAAGGTCCTCATCAGCGACCCCAGCTGGGAAAACCACCGCGCCCTGTTC
+GAGCGCGCCGGCTTCCCGGTCGAGACCTACGCTTATTACGATGCCGCCACCCATGGCCTGAACTTCGAAG
+CCATGCTGGCCGCCCTGCAGGCCGCGCCCGAACAGACCATCGTGGTGCTGCACGCCTGCTGCCACAACCC
+GACCGGCGTCGATCCCACGCCGCAACAGTGGGAACAGATCGCCGCCGTGGTCAAGGCGCGCAACCTGGTG
+CCGTTCCTCGACATCGCCTACCAGGGCTTCGGCGAAGGCCTGGAGCAGGACGCCGCCGTGGTGCGCATGT
+TCGCCGAGCTCGACCTGACCATGTTCATCAGCTCGTCGTTCTCCAAGTCCTTCTCGCTGTATGGCGAGCG
+GGTCGGGGCCCTGACCGTGGTGGCCGGCAGCAAGGACGAGGCCGCCCGCGTGCTCAGCCAGCTCAAGCGC
+GTGATCCGCACCAACTACTCCAACCCGCCCACCCACGGCGGCACCGTGGTGTCCACGGTCCTGAACACAC
+CCGAGCTGTTCGCGCTCTGGGAAAATGAACTGGCCGGCATGCGCGACCGCATCCGCCTGATGCGCAAGGA
+GCTGGTCGAGAAGATCAAGACCCAGGGCGTGGCGCAGGACTTCAGCTTCGTGCTGGCGCAGCGCGGCATG
+TTCTCGTACTCGGGCCTGACCGCCGCCCAGGTCGATCGCCTGCGCGAAGAGCACGGCATCTACGCGGTCT
+CCAGCGGCCGCATCTGCGTGGCCGCGCTCAACAGCCGCAACATCGACGCGGTCGCGGCCGGCATCGCCGC
+GGTGCTGAAGTAG