Added predetermined headers feature

Increased timeout to 5 minutes
Added client error as acceptable exception
2025-03-14 14:26:43 +00:00 · 2025-03-13 18:37:33 +00:00 · 2025-03-13 18:13:38 +00:00 · 2025-03-13 16:51:15 +00:00 · 2025-03-13 16:27:59 +00:00 · 2025-03-13 16:13:14 +00:00
23 changed files with 712 additions and 334 deletions
--- a/.devcontainer/Dockerfile
+++ b/.devcontainer/Dockerfile
@ -0,0 +1,11 @@
+FROM mcr.microsoft.com/devcontainers/anaconda:1-3
+
+# Copy environment.yml (if found) to a temp location so we update the environment. Also
+# copy "noop.txt" so the COPY instruction does not fail if no environment.yml exists.
+COPY environment.yml* .devcontainer/noop.txt /tmp/conda-tmp/
+RUN if [ -f "/tmp/conda-tmp/environment.yml" ]; then umask 0002 && /opt/conda/bin/conda env update -n base -f /tmp/conda-tmp/environment.yml; fi \
+    && rm -rf /tmp/conda-tmp
+
+# [Optional] Uncomment this section to install additional OS packages.
+# RUN apt-get update && export DEBIAN_FRONTEND=noninteractive \
+#     && apt-get -y install --no-install-recommends <your-package-list-here>
--- a/.devcontainer/devcontainer.json
+++ b/.devcontainer/devcontainer.json
@ -1,9 +1,11 @@
 // For format details, see https://aka.ms/devcontainer.json. For config options, see the
-// README at: https://github.com/devcontainers/templates/tree/main/src/python
+// README at: https://github.com/devcontainers/templates/tree/main/src/anaconda
 {
-	"name": "Python 3",
-	// Or use a Dockerfile or Docker Compose file. More info: https://containers.dev/guide/dockerfile
-	"image": "mcr.microsoft.com/devcontainers/python:1-3.12-bullseye",
+	"name": "Anaconda (Python 3)",
+	"build": { 
+		"context": "..",
+		"dockerfile": "Dockerfile"
+	}

 	// Features to add to the dev container. More info: https://containers.dev/features.
 	// "features": {},
@ -12,14 +14,7 @@
 	// "forwardPorts": [],

 	// Use 'postCreateCommand' to run commands after the container is created.
-	"postCreateCommand": "pip3 install --user -r requirements.txt",
-	"customizations": {
-		"vscode": {
-			"extensions": [
-				"mechatroner.rainbow-csv"
-			]
-		}
-	}
+	// "postCreateCommand": "python --version",

 	// Configure tool-specific properties.
 	// "customizations": {},
--- a/.devcontainer/noop.txt
+++ b/.devcontainer/noop.txt
@ -0,0 +1,3 @@
+This file copied into the container along with environment.yml* from the parent
+folder. This file is included to prevents the Dockerfile COPY instruction from 
+failing if no environment.yml is found.
--- a/.gitignore
+++ b/.gitignore
@ -1,6 +1,6 @@
 # File created using '.gitignore Generator' for Visual Studio Code: https://bit.ly/vscode-gig
-# Created by https://www.toptal.com/developers/gitignore/api/visualstudiocode,svelte,python,linux,node
-# Edit at https://www.toptal.com/developers/gitignore?templates=visualstudiocode,svelte,python,linux,node
+# Created by https://www.toptal.com/developers/gitignore/api/visualstudiocode,linux,python
+# Edit at https://www.toptal.com/developers/gitignore?templates=visualstudiocode,linux,python

 ### Linux ###
 *~
@ -17,146 +17,6 @@
 # .nfs files are created when an open file is removed but is still being accessed
 .nfs*

-### Node ###
-# Logs
-logs
-*.log
-npm-debug.log*
-yarn-debug.log*
-yarn-error.log*
-lerna-debug.log*
-.pnpm-debug.log*
-
-# Diagnostic reports (https://nodejs.org/api/report.html)
-report.[0-9]*.[0-9]*.[0-9]*.[0-9]*.json
-
-# Runtime data
-pids
-*.pid
-*.seed
-*.pid.lock
-
-# Directory for instrumented libs generated by jscoverage/JSCover
-lib-cov
-
-# Coverage directory used by tools like istanbul
-coverage
-*.lcov
-
-# nyc test coverage
-.nyc_output
-
-# Grunt intermediate storage (https://gruntjs.com/creating-plugins#storing-task-files)
-.grunt
-
-# Bower dependency directory (https://bower.io/)
-bower_components
-
-# node-waf configuration
-.lock-wscript
-
-# Compiled binary addons (https://nodejs.org/api/addons.html)
-build/Release
-
-# Dependency directories
-node_modules/
-jspm_packages/
-
-# Snowpack dependency directory (https://snowpack.dev/)
-web_modules/
-
-# TypeScript cache
-*.tsbuildinfo
-
-# Optional npm cache directory
-.npm
-
-# Optional eslint cache
-.eslintcache
-
-# Optional stylelint cache
-.stylelintcache
-
-# Microbundle cache
-.rpt2_cache/
-.rts2_cache_cjs/
-.rts2_cache_es/
-.rts2_cache_umd/
-
-# Optional REPL history
-.node_repl_history
-
-# Output of 'npm pack'
-*.tgz
-
-# Yarn Integrity file
-.yarn-integrity
-
-# dotenv environment variable files
-.env
-.env.development.local
-.env.test.local
-.env.production.local
-.env.local
-
-# parcel-bundler cache (https://parceljs.org/)
-.cache
-.parcel-cache
-
-# Next.js build output
-.next
-out
-
-# Nuxt.js build / generate output
-.nuxt
-dist
-
-# Gatsby files
-.cache/
-# Comment in the public line in if your project uses Gatsby and not Next.js
-# https://nextjs.org/blog/next-9-1#public-directory-support
-# public
-
-# vuepress build output
-.vuepress/dist
-
-# vuepress v2.x temp and cache directory
-.temp
-
-# Docusaurus cache and generated files
-.docusaurus
-
-# Serverless directories
-.serverless/
-
-# FuseBox cache
-.fusebox/
-
-# DynamoDB Local files
-.dynamodb/
-
-# TernJS port file
-.tern-port
-
-# Stores VSCode versions used for testing VSCode extensions
-.vscode-test
-
-# yarn v2
-.yarn/cache
-.yarn/unplugged
-.yarn/build-state.yml
-.yarn/install-state.gz
-.pnp.*
-
-### Node Patch ###
-# Serverless Webpack directories
-.webpack/
-
-# Optional stylelint cache
-
-# SvelteKit build / generate output
-.svelte-kit
-
 ### Python ###
 # Byte-compiled / optimized / DLL files
 __pycache__/
@ -202,6 +62,7 @@ htmlcov/
 .nox/
 .coverage
 .coverage.*
+.cache
 nosetests.xml
 coverage.xml
 *.cover
@ -215,6 +76,7 @@ cover/
 *.pot

 # Django stuff:
+*.log
 local_settings.py
 db.sqlite3
 db.sqlite3-journal
@ -278,6 +140,7 @@ celerybeat.pid
 *.sage.py

 # Environments
+.env
 .venv
 env/
 venv/
@ -326,13 +189,6 @@ poetry.toml
 # LSP config files
 pyrightconfig.json

-### Svelte ###
-# gitignore template for the SvelteKit, frontend web component framework
-# website: https://kit.svelte.dev/
-
-.svelte-kit/
-package
-
 ### VisualStudioCode ###
 .vscode/*
 !.vscode/settings.json
@ -352,9 +208,8 @@ package
 .history
 .ionide

-# End of https://www.toptal.com/developers/gitignore/api/visualstudiocode,svelte,python,linux,node
+# End of https://www.toptal.com/developers/gitignore/api/visualstudiocode,linux,python

 # Custom rules (everything added below won't be overriden by 'Generate .gitignore File' if you use 'Update' option)

-output
-*.private.*
+conda-bld
--- a/.vscode/extensions.json
+++ b/.vscode/extensions.json
@ -0,0 +1,6 @@
+{
+    "recommendations": [
+        "piotrpalarz.vscode-gitignore-generator",
+        "gruntfuggly.todo-tree"
+    ]
+}
--- a/.vscode/launch.json
+++ b/.vscode/launch.json
@ -1,25 +0,0 @@
-{
-    // Use IntelliSense to learn about possible attributes.
-    // Hover to view descriptions of existing attributes.
-    // For more information, visit: https://go.microsoft.com/fwlink/?linkid=830387
-    "version": "0.2.0",
-    "configurations": [
-        
-        {
-            "name": "autobigs info -lschema pubmlst_bordetella_seqdef",
-            "type": "debugpy",
-            "request": "launch",
-            "program": "${workspaceFolder}/src/autobigs/cli/program.py",
-            "console": "integratedTerminal",
-            "args": [
-                "info",
-                "-lschemas",
-                "pubmlst_bordetella_seqdef"
-            ],
-            "cwd": "${workspaceFolder}/src",
-            "env": {
-                "PYTHONPATH": "${workspaceFolder}/src"
-            }
-        }
-    ]
-}
--- a/22
+++ b/22
@ -2,14 +2,14 @@ pipeline {
    agent {
        kubernetes {
            cloud 'rsys-devel'
-            defaultContainer 'pip'
-            inheritFrom 'pip'
+            defaultContainer 'miniforge3'
+            inheritFrom 'miniforge'
        }
    }
    stages {
        stage("install") {
            steps {
-                sh 'python -m pip install -r requirements.txt'
+                sh 'conda env update -n base -f environment.yml'
            }
        }
        stage("unit tests") {
@ -22,26 +22,36 @@ pipeline {
        stage("build") {
            steps {
                sh "python -m build"
+                sh "grayskull pypi dist/*.tar.gz --maintainers 'Harrison Deng'"
+                sh "python scripts/patch_recipe.py"
+                sh 'conda build autobigs-engine -c bioconda --output-folder conda-bld --verify'
            }
        }
        stage("archive") {
            steps {
-                archiveArtifacts artifacts: 'dist/*.tar.gz, dist/*.whl', fingerprint: true, followSymlinks: false, onlyIfSuccessful: true
+                archiveArtifacts artifacts: 'dist/*.tar.gz, dist/*.whl, conda-bld/**/*.conda', fingerprint: true, followSymlinks: false, onlyIfSuccessful: true
            }
        }
        stage("publish") {
            parallel {
                stage ("git.reslate.systems") {
+                    when {
+                        not {
+                            tag '*.*.*'
+                        }
+                    }
+
                    environment {
                        CREDS = credentials('username-password-rs-git')
                    }
                    steps {
-                        sh returnStatus: true, script: 'python -m twine upload --repository-url https://git.reslate.systems/api/packages/ydeng/pypi -u ${CREDS_USR} -p ${CREDS_PSW} --non-interactive --disable-progress-bar --verbose dist/*'
+                        sh 'python -m twine upload --repository-url https://git.reslate.systems/api/packages/ydeng/pypi -u ${CREDS_USR} -p ${CREDS_PSW} --non-interactive --disable-progress-bar --verbose dist/*'
+                        sh 'curl --user ${CREDS_USR}:${CREDS_PSW} --upload-file conda-bld/**/*.conda https://git.reslate.systems/api/packages/${CREDS_USR}/conda/$(basename conda-bld/**/*.conda)'
                    }
                }
                stage ("pypi.org") {
                    when {
-                        tag '*.*'
+                        tag '*.*.*'
                    }
                    environment {
                        TOKEN = credentials('pypi.org')
--- a/README.md
+++ b/README.md
@ -1,13 +1,14 @@
-# autoBIGS.Engine
+# autoBIGS.engine

 A python library implementing common BIGSdb MLST schemes and databases accesses for the purpose of typing sequences automatically. Implementation follows the RESTful API outlined by the official [BIGSdb documentation](https://bigsdb.readthedocs.io/en/latest/rest.html) up to `V1.50.0`.

+
 ## Features

 Briefly, this library can:
 - Import multiple `FASTA` files
 - Fetch the available BIGSdb databases that is currently live and available
- Fetch the available BIGSdb database schemas for a given MLST database
+- Fetch the available BIGSdb database schemes for a given MLST database
 - Retrieve exact/non-exact MLST allele variant IDs based off a sequence
 - Retrieve MLST sequence type IDs based off a sequence
 - Output all results to a single CSV
@ -23,3 +24,15 @@ Then, it's as easy as running `pip install autobigs-engine` in any terminal that
 ### CLI usage

 This is a independent python library and thus does not have any form of direct user interface. One way of using it could be to create your own Python script that makes calls to this libraries functions. Alternatively, you may use `autobigs-cli`, a `Python` package that implements a CLI for calling this library.
+
+## Versioning
+
+the autoBIGS project follows [semantic versioning](https://semver.org/) where the three numbers may be interpreted as MAJOR.MINOR.PATCH.
+
+Note regarding major version 0 ([spec item 4](https://semver.org/#spec-item-4)), the following adaptation of semantic versioning definition is as follows:
+
+1. Given x.Y.z, Y is only incremented when a backwards incompatible change is made.
+
+2. Given x.y.Z, Z is only incremented when a backwards compatible change is made.
+
+Versions of autoBIGS items with a major version number of 0 will introduce numerous changes and patches. As such, changes between such versions should be considered highly variable.
--- a/environment.yml
+++ b/environment.yml
@ -0,0 +1,16 @@
+name: ci
+channels:
+  - bioconda
+  - conda-forge
+dependencies:
+  - aiohttp==3.11.*
+  - biopython==1.85
+  - pytest
+  - pytest-asyncio
+  - python-build
+  - conda-build
+  - twine==6.0.1
+  - setuptools_scm
+  - pytest-cov
+  - grayskull
+  - curl
--- a/pyproject.toml
+++ b/pyproject.toml
@ -13,11 +13,12 @@ dependencies = [
 ]
 requires-python = ">=3.12"
 description = "A library to rapidly fetch fetch MLST profiles given sequences for various diseases."
+license = {text = "GPL-3.0-or-later"}

 [project.urls]
-Homepage = "https://github.com/RealYHD/autoBIGS.engine"
-Source = "https://github.com/RealYHD/autoBIGS.engine"
-Issues = "https://github.com/RealYHD/autoBIGS.engine/issues"
+Homepage = "https://github.com/Syph-and-VPD-Lab/autoBIGS.engine"
+Source = "https://github.com/Syph-and-VPD-Lab/autoBIGS.engine"
+Issues = "https://github.com/Syph-and-VPD-Lab/autoBIGS.engine/issues"

 [tool.setuptools_scm]

--- a/requirements.txt
+++ b/requirements.txt
@ -1,8 +0,0 @@
-aiohttp[speedups]==3.11.*
-biopython==1.85
-pytest
-pytest-asyncio
-build
-twine
-setuptools_scm
-pytest-cov
--- a/scripts/patch_recipe.py
+++ b/scripts/patch_recipe.py
@ -0,0 +1,103 @@
+#!/usr/bin/env python3
+
+import argparse
+from os import fdopen, path
+import os
+import re
+import shutil
+from sys import argv
+import tempfile
+
+INDENTATION = "  "
+GRAYSKULL_OUTPUT_PATH = "autoBIGS.engine"
+RUN_EXPORTED_VALUE = r'{{ pin_subpackage( name|lower|replace(".", "-"), max_pin="x.x") }}'
+LICENSE_SUFFIX = "-or-later"
+HOME_PAGE = "https://github.com/Syph-and-VPD-Lab/autoBIGS.engine"
+
+def _calc_indentation(line: str):
+    return len(re.findall(INDENTATION, line.split(line.strip())[0])) if line != "\n" else 0
+
+def read_grayskull_output():
+    original_recipe = path.abspath(GRAYSKULL_OUTPUT_PATH)
+    original_meta = path.join(original_recipe, "meta.yaml")
+    meta_file = open(original_meta)
+    lines = meta_file.readlines()
+    meta_file.close()
+    return lines
+
+def update_naming_scheme(lines):
+    modified_lines = []
+    for line in lines:
+        matches = re.finditer(r"\{\{\s*name\|lower()\s+\}\}", line)
+        modified_line = line
+        for match in matches:
+            modified_line = modified_line[:match.start(1)] + r'|replace(".", "-")' + modified_line[match.end(1):]
+        modified_lines.append(modified_line)
+    return modified_lines
+
+def inject_run_exports(lines: list[str]):
+    package_indent = False
+    modified_lines = []
+    for line in lines:
+        indentation_count = _calc_indentation(line)
+        if line == "build:\n" and indentation_count == 0:
+            package_indent = True
+            modified_lines.append(line)
+        elif package_indent and indentation_count == 0:
+            modified_lines.append(INDENTATION*1 + "run_exports:\n")
+            modified_lines.append(INDENTATION*2 + "- " + RUN_EXPORTED_VALUE + "\n")
+            package_indent = False
+        else:
+            modified_lines.append(line)
+    return modified_lines
+
+def suffix_license(lines: list[str]):
+    about_indent = False
+    modified_lines = []
+    for line in lines:
+        indentation_count = _calc_indentation(line)
+        if line == "about:\n" and indentation_count == 0:
+            about_indent = True
+            modified_lines.append(line)
+        elif about_indent and indentation_count == 1 and line.lstrip().startswith("license:"):
+            modified_lines.append(line.rstrip() + LICENSE_SUFFIX  + "\n")
+            about_indent = False
+        else:
+            modified_lines.append(line)
+    return modified_lines
+
+def inject_home_page(lines: list[str]):
+    about_indent = False
+    modified_lines = []
+    for line in lines:
+        indentation_count = _calc_indentation(line)
+        if line == "about:\n" and indentation_count == 0:
+            about_indent = True
+            modified_lines.append(line)
+        elif about_indent and indentation_count == 0:
+            modified_lines.append(INDENTATION + "home: " + HOME_PAGE + "\n")
+            about_indent = False
+        else:
+            modified_lines.append(line)
+    return modified_lines
+
+def write_to_original(lines: list[str]):
+    original_recipe = path.abspath(GRAYSKULL_OUTPUT_PATH)
+    original_meta = path.join(original_recipe, "meta.yaml")
+    with open(original_meta, "w") as file:
+        file.writelines(lines)
+
+def rename_recipe_dir():
+    new_recipe_name = path.abspath(path.join(GRAYSKULL_OUTPUT_PATH.replace(".", "-").lower()))
+    shutil.rmtree(new_recipe_name, ignore_errors=True)
+    os.replace(path.abspath(GRAYSKULL_OUTPUT_PATH), new_recipe_name)
+
+if __name__ == "__main__":
+    original_grayskull_out = read_grayskull_output()
+    modified_recipe_meta = None
+    modified_recipe_meta = update_naming_scheme(original_grayskull_out)
+    modified_recipe_meta = inject_run_exports(modified_recipe_meta)
+    modified_recipe_meta = suffix_license(modified_recipe_meta)
+    modified_recipe_meta = inject_home_page(modified_recipe_meta)
+    write_to_original(modified_recipe_meta)
+    rename_recipe_dir()
--- a/src/autobigs/engine/analysis/bigsdb.py
+++ b/src/autobigs/engine/analysis/bigsdb.py
@ -7,9 +7,9 @@ from os import path
 import os
 import shutil
 import tempfile
-from typing import Any, AsyncGenerator, AsyncIterable, Iterable, Mapping, Sequence, Set, Union
+from typing import Any, AsyncGenerator, AsyncIterable, Coroutine, Iterable, Mapping, Sequence, Set, Union

-from aiohttp import ClientSession, ClientTimeout
+from aiohttp import ClientOSError, ClientSession, ClientTimeout, ServerDisconnectedError

 from autobigs.engine.reading import read_fasta
 from autobigs.engine.structures.alignment import PairwiseAlignment
@ -22,15 +22,15 @@ from Bio.Align import PairwiseAligner
 class BIGSdbMLSTProfiler(AbstractAsyncContextManager):

    @abstractmethod
-    def determine_mlst_allele_variants(self, query_sequence_strings: Iterable[str]) -> AsyncGenerator[Allele, Any]:
+    def determine_mlst_allele_variants(self, query_sequence_strings: Union[Iterable[Union[NamedString, str]], Union[NamedString, str]]) -> AsyncGenerator[Union[Allele, tuple[str, Allele]], Any]:
        pass

    @abstractmethod
-    async def determine_mlst_st(self, alleles: Union[AsyncIterable[Allele], Iterable[Allele]]) -> MLSTProfile:
+    async def determine_mlst_st(self, alleles: Union[AsyncIterable[Union[Allele, tuple[str, Allele]]], Iterable[Union[Allele, tuple[str, Allele]]]]) -> Union[MLSTProfile, NamedMLSTProfile]:
        pass

    @abstractmethod
-    async def profile_string(self, query_sequence_strings: Iterable[str]) -> MLSTProfile:
+    async def profile_string(self, query_sequence_strings: Iterable[Union[NamedString, str]]) -> Union[NamedMLSTProfile, MLSTProfile]:
        pass

    @abstractmethod
@ -43,94 +43,156 @@ class BIGSdbMLSTProfiler(AbstractAsyncContextManager):

 class RemoteBIGSdbMLSTProfiler(BIGSdbMLSTProfiler):

-    def __init__(self, database_api: str, database_name: str, schema_id: int):
+    def __init__(self, database_api: str, database_name: str, scheme_id: int, retry_requests: int = 5):
+        self._retry_limit = retry_requests
        self._database_name = database_name
-        self._schema_id = schema_id
-        self._base_url = f"{database_api}/db/{self._database_name}/schemes/{self._schema_id}/"
-        self._http_client = ClientSession(self._base_url, timeout=ClientTimeout(60))
+        self._scheme_id = scheme_id
+        self._base_url = f"{database_api}/db/{self._database_name}/schemes/{self._scheme_id}/"
+        self._http_client = ClientSession(self._base_url, timeout=ClientTimeout(300))

    async def __aenter__(self):
        return self

-    async def determine_mlst_allele_variants(self, query_sequence_strings: Union[Iterable[str], str]) -> AsyncGenerator[Allele, Any]:
+    async def determine_mlst_allele_variants(self, query_sequence_strings: Union[Iterable[Union[NamedString, str]], Union[NamedString, str]]) -> AsyncGenerator[Union[Allele, tuple[str, Allele]], Any]:
        # See https://bigsdb.pasteur.fr/api/db/pubmlst_bordetella_seqdef/schemes
        uri_path = "sequence"
-        if isinstance(query_sequence_strings, str):
+        if isinstance(query_sequence_strings, str) or isinstance(query_sequence_strings, NamedString):
            query_sequence_strings = [query_sequence_strings]
+        
        for sequence_string in query_sequence_strings:
-            async with self._http_client.post(uri_path, json={
-                "sequence": sequence_string,
-                "partial_matches": True
-            }) as response:
-                sequence_response: dict = await response.json()
+            attempts = 0
+            success = False
+            last_error = None
+            while not success and attempts < self._retry_limit:
+                attempts += 1
+                request = self._http_client.post(uri_path, json={
+                    "sequence": sequence_string if isinstance(sequence_string, str) else sequence_string.sequence,
+                    "partial_matches": True
+                })
+                try:
+                    async with request as response:
+                        sequence_response: dict = await response.json()

-                if "exact_matches" in sequence_response:
-                    # loci -> list of alleles with id and loci
-                    exact_matches: dict[str, Sequence[dict[str, str]]] = sequence_response["exact_matches"]  
-                    for allele_loci, alleles in exact_matches.items():
-                        for allele in alleles:
-                            alelle_id = allele["allele_id"]
-                            yield Allele(allele_locus=allele_loci, allele_variant=alelle_id, partial_match_profile=None)
-                elif "partial_matches" in sequence_response:
-                    partial_matches: dict[str, dict[str, Union[str, float, int]]] = sequence_response["partial_matches"] 
-                    for allele_loci, partial_match in partial_matches.items():
-                        if len(partial_match) <= 0:
-                            continue
-                        partial_match_profile = AlignmentStats(
-                            percent_identity=float(partial_match["identity"]),
-                            mismatches=int(partial_match["mismatches"]),
-                            gaps=int(partial_match["gaps"]),
-                            match_metric=int(partial_match["bitscore"])
-                        )
-                        yield Allele(
-                            allele_locus=allele_loci,
-                            allele_variant=str(partial_match["allele"]),
-                            partial_match_profile=partial_match_profile
-                        )
+                        if "exact_matches" in sequence_response:
+                            # loci -> list of alleles with id and loci
+                            exact_matches: dict[str, Sequence[dict[str, str]]] = sequence_response["exact_matches"]  
+                            for allele_loci, alleles in exact_matches.items():
+                                for allele in alleles:
+                                    alelle_id = allele["allele_id"]
+                                    result_allele = Allele(allele_locus=allele_loci, allele_variant=alelle_id, partial_match_profile=None)
+                                    yield result_allele if isinstance(sequence_string, str) else (sequence_string.name, result_allele)
+                        elif "partial_matches" in sequence_response:
+                            partial_matches: dict[str, dict[str, Union[str, float, int]]] = sequence_response["partial_matches"] 
+                            for allele_loci, partial_match in partial_matches.items():
+                                if len(partial_match) <= 0:
+                                    continue
+                                partial_match_profile = AlignmentStats(
+                                    percent_identity=float(partial_match["identity"]),
+                                    mismatches=int(partial_match["mismatches"]),
+                                    gaps=int(partial_match["gaps"]),
+                                    match_metric=int(partial_match["bitscore"])
+                                )
+                                result_allele = Allele(
+                                    allele_locus=allele_loci,
+                                    allele_variant=str(partial_match["allele"]),
+                                    partial_match_profile=partial_match_profile
+                                )
+                                yield result_allele if isinstance(sequence_string, str) else (sequence_string.name, result_allele)
+                        else:
+                            raise NoBIGSdbMatchesException(self._database_name, self._scheme_id, sequence_string.name if isinstance(sequence_string, NamedString) else None)
+                except (ConnectionError, ServerDisconnectedError, ClientOSError) as e: # Errors we will retry
+                    last_error = e
+                    success = False
+                    await asyncio.sleep(5) # In case the connection issue is due to rate issues
                else:
-                    raise NoBIGSdbMatchesException(self._database_name, self._schema_id)
+                    success = True
+            if not success and last_error is not None:
+                try:
+                    raise last_error
+                except (ConnectionError, ServerDisconnectedError, ClientOSError) as e: # Non-fatal errors
+                    yield Allele("error", "error", None)

-    async def determine_mlst_st(self, alleles: Union[AsyncIterable[Allele], Iterable[Allele]]) -> MLSTProfile:
+    async def determine_mlst_st(self, alleles: Union[AsyncIterable[Union[Allele, tuple[str, Allele]]], Iterable[Union[Allele, tuple[str, Allele]]]]) -> Union[MLSTProfile, NamedMLSTProfile]:
        uri_path = "designations"
        allele_request_dict: dict[str, list[dict[str, str]]] = defaultdict(list)
+        names_list = []
+        def insert_allele_to_request_dict(allele: Union[Allele, tuple[str, Allele]]):
+            if isinstance(allele, Allele):
+                allele_val = allele
+            else:
+                allele_val = allele[1]
+                names_list.append(allele[0])
+            allele_request_dict[allele_val.allele_locus].append({"allele": str(allele_val.allele_variant)})
+
        if isinstance(alleles, AsyncIterable):
            async for allele in alleles:
-                allele_request_dict[allele.allele_locus].append({"allele": str(allele.allele_variant)})
+                insert_allele_to_request_dict(allele)
        else:
            for allele in alleles:
-                allele_request_dict[allele.allele_locus].append({"allele": str(allele.allele_variant)})
+                insert_allele_to_request_dict(allele)
        request_json = {
            "designations": allele_request_dict
        }
-        async with self._http_client.post(uri_path, json=request_json) as response:
-            response_json: dict = await response.json()
-            allele_set: Set[Allele] = set()
-            response_json.setdefault("fields", dict())
-            schema_fields_returned: dict[str, str] = response_json["fields"]
-            schema_fields_returned.setdefault("ST", "unknown")
-            schema_fields_returned.setdefault("clonal_complex", "unknown")
-            schema_exact_matches: dict = response_json["exact_matches"]
-            for exact_match_locus, exact_match_alleles in schema_exact_matches.items():
-                if len(exact_match_alleles) > 1:
-                    raise ValueError(f"Unexpected number of alleles returned for exact match (Expected 1, retrieved {len(exact_match_alleles)})")
-                allele_set.add(Allele(exact_match_locus, exact_match_alleles[0]["allele_id"], None))
-            if len(allele_set) == 0:
-                raise ValueError("Passed in no alleles.")
-            return MLSTProfile(allele_set, schema_fields_returned["ST"], schema_fields_returned["clonal_complex"])

-    async def profile_string(self, query_sequence_strings: Iterable[str]) -> MLSTProfile:
+        attempts = 0
+        success = False
+        last_error = None
+        while attempts < self._retry_limit and not success:
+            attempts += 1
+            try:
+                async with self._http_client.post(uri_path, json=request_json) as response:
+                    response_json: dict = await response.json()
+                    allele_set: Set[Allele] = set()
+                    response_json.setdefault("fields", dict())
+                    scheme_fields_returned: dict[str, str] = response_json["fields"]
+                    scheme_fields_returned.setdefault("ST", "unknown")
+                    scheme_fields_returned.setdefault("clonal_complex", "unknown")
+                    scheme_exact_matches: dict = response_json["exact_matches"]
+                    for exact_match_locus, exact_match_alleles in scheme_exact_matches.items():
+                        allele_set.add(Allele(exact_match_locus, exact_match_alleles[0]["allele_id"], None))
+                    if len(allele_set) == 0:
+                        raise ValueError("Passed in no alleles.")
+                    result_mlst_profile = MLSTProfile(allele_set, scheme_fields_returned["ST"], scheme_fields_returned["clonal_complex"])
+                    if len(names_list) > 0:
+                        result_mlst_profile = NamedMLSTProfile(str(tuple(names_list)) if len(set(names_list)) > 1 else names_list[0], result_mlst_profile)
+                    return result_mlst_profile
+            except (ConnectionError, ServerDisconnectedError, ClientOSError) as e:
+                last_error = e
+                success = False
+                await asyncio.sleep(5)
+            else:
+                success = True
+        try:
+            if last_error is not None:
+                raise last_error
+        except (ConnectionError, ServerDisconnectedError, ClientOSError) as e:
+                result_mlst_profile = NamedMLSTProfile((str(tuple(names_list)) if len(set(names_list)) > 1 else names_list[0]) + ":Error", None)
+        raise ValueError("Last error was not recorded.")
+
+                    
+    async def profile_string(self, query_sequence_strings: Iterable[Union[NamedString, str]]) -> Union[NamedMLSTProfile, MLSTProfile]:
        alleles = self.determine_mlst_allele_variants(query_sequence_strings)
        return await self.determine_mlst_st(alleles)

    async def profile_multiple_strings(self, query_named_string_groups: AsyncIterable[Iterable[NamedString]], stop_on_fail: bool = False) -> AsyncGenerator[NamedMLSTProfile, Any]:
+        tasks: list[Coroutine[Any, Any, Union[NamedMLSTProfile, MLSTProfile]]] = []
        async for named_strings in query_named_string_groups:
-            for named_string in named_strings:
-                try:
-                    yield NamedMLSTProfile(named_string.name, (await self.profile_string([named_string.sequence])))
-                except NoBIGSdbMatchesException as e:
-                    if stop_on_fail:
-                        raise e
-                    yield NamedMLSTProfile(named_string.name, None)
+            tasks.append(self.profile_string(named_strings))
+        for task in asyncio.as_completed(tasks):
+            named_mlst_profile = await task
+            try:
+                if isinstance(named_mlst_profile, NamedMLSTProfile):
+                    yield named_mlst_profile
+                else:
+                    raise TypeError("MLST profile is not named.")
+            except NoBIGSdbMatchesException as e:
+                if stop_on_fail:
+                    raise e
+                causal_name = e.get_causal_query_name()
+                if causal_name is None:
+                    raise ValueError("Missing query name despite requiring names.")
+                else:
+                    yield NamedMLSTProfile(causal_name, None)

    async def close(self):
        await self._http_client.close()
@ -147,7 +209,7 @@ class BIGSdbIndex(AbstractAsyncContextManager):
    def __init__(self):
        self._http_client = ClientSession()
        self._known_seqdef_dbs_origin: Union[Mapping[str, str], None] = None
-        self._seqdefdb_schemas: dict[str, Union[Mapping[str, int], None]] = dict()
+        self._seqdefdb_schemes: dict[str, Union[Mapping[str, int], None]] = dict()
        super().__init__()

    async def __aenter__(self):
@ -173,22 +235,32 @@ class BIGSdbIndex(AbstractAsyncContextManager):
            raise NoSuchBIGSdbDatabaseException(seqdef_db_name)
        return known_databases[seqdef_db_name]     

-    async def get_schemas_for_seqdefdb(self, seqdef_db_name: str, force: bool = False) -> Mapping[str, int]:
-        if seqdef_db_name in self._seqdefdb_schemas and not force:
-            return self._seqdefdb_schemas[seqdef_db_name] # type: ignore since it's guaranteed to not be none by conditional
+    async def get_schemes_for_seqdefdb(self, seqdef_db_name: str, force: bool = False) -> Mapping[str, int]:
+        if seqdef_db_name in self._seqdefdb_schemes and not force:
+            return self._seqdefdb_schemes[seqdef_db_name] # type: ignore since it's guaranteed to not be none by conditional
        uri_path = f"{await self.get_bigsdb_api_from_seqdefdb(seqdef_db_name)}/db/{seqdef_db_name}/schemes"
        async with self._http_client.get(uri_path) as response: 
            response_json = await response.json()
-            schema_descriptions: Mapping[str, int] = dict()
+            scheme_descriptions: Mapping[str, int] = dict()
            for scheme_definition in response_json["schemes"]:
                scheme_id: int = int(str(scheme_definition["scheme"]).split("/")[-1])
                scheme_desc: str = scheme_definition["description"]
-                schema_descriptions[scheme_desc] = scheme_id
-            self._seqdefdb_schemas[seqdef_db_name] = schema_descriptions
-            return self._seqdefdb_schemas[seqdef_db_name] # type: ignore
+                scheme_descriptions[scheme_desc] = scheme_id
+            self._seqdefdb_schemes[seqdef_db_name] = scheme_descriptions
+            return self._seqdefdb_schemes[seqdef_db_name] # type: ignore

-    async def build_profiler_from_seqdefdb(self, local: bool, dbseqdef_name: str, schema_id: int) -> BIGSdbMLSTProfiler:
-        return get_BIGSdb_MLST_profiler(local, await self.get_bigsdb_api_from_seqdefdb(dbseqdef_name), dbseqdef_name, schema_id)
+    async def build_profiler_from_seqdefdb(self, local: bool, dbseqdef_name: str, scheme_id: int) -> BIGSdbMLSTProfiler:
+        return get_BIGSdb_MLST_profiler(local, await self.get_bigsdb_api_from_seqdefdb(dbseqdef_name), dbseqdef_name, scheme_id)
+    
+    async def get_scheme_loci(self, dbseqdef_name: str, scheme_id: int) -> list[str]:
+        uri_path = f"{await self.get_bigsdb_api_from_seqdefdb(dbseqdef_name)}/db/{dbseqdef_name}/schemes/{scheme_id}"
+        async with self._http_client.get(uri_path) as response:
+            response_json = await response.json()
+            loci = response_json["loci"]
+            results = []
+            for locus in loci:
+                results.append(path.basename(locus))
+            return results

    async def close(self):
        await self._http_client.close()
@ -196,7 +268,7 @@ class BIGSdbIndex(AbstractAsyncContextManager):
    async def __aexit__(self, exc_type, exc_value, traceback):
        await self.close()

-def get_BIGSdb_MLST_profiler(local: bool, database_api: str, database_name: str, schema_id: int):
+def get_BIGSdb_MLST_profiler(local: bool, database_api: str, database_name: str, scheme_id: int):
    if local:
        raise NotImplementedError()
-    return RemoteBIGSdbMLSTProfiler(database_api=database_api, database_name=database_name, schema_id=schema_id)
+    return RemoteBIGSdbMLSTProfiler(database_api=database_api, database_name=database_name, scheme_id=scheme_id)
--- a/src/autobigs/engine/exceptions/database.py
+++ b/src/autobigs/engine/exceptions/database.py
@ -5,17 +5,21 @@ class BIGSDbDatabaseAPIException(Exception):


 class NoBIGSdbMatchesException(BIGSDbDatabaseAPIException):
-    def __init__(self, database_name: str, database_schema_id: int, *args):
-        super().__init__(f"No matches found with schema with ID {database_schema_id}  in the database \"{database_name}\".", *args)
+    def __init__(self, database_name: str, database_scheme_id: int, query_name: Union[None, str], *args):
+        self._query_name = query_name
+        super().__init__(f"No matches found with scheme with ID {database_scheme_id}  in the database \"{database_name}\".", *args)
+    
+    def get_causal_query_name(self) -> Union[str, None]:
+        return self._query_name

 class NoBIGSdbExactMatchesException(NoBIGSdbMatchesException):
-    def __init__(self, database_name: str, database_schema_id: int, *args):
-        super().__init__(f"No exact match found with schema with ID {database_schema_id}  in the database \"{database_name}\".", *args)
+    def __init__(self, database_name: str, database_scheme_id: int, *args):
+        super().__init__(f"No exact match found with scheme with ID {database_scheme_id}  in the database \"{database_name}\".", *args)

 class NoSuchBIGSdbDatabaseException(BIGSDbDatabaseAPIException):
    def __init__(self, database_name: str, *args):
        super().__init__(f"No database \"{database_name}\" found.", *args)

-class NoSuchBigSdbSchemaException(BIGSDbDatabaseAPIException):
-    def __init__(self, database_name: str, database_schema_id: int, *args):
-        super().__init__(f"No schema with ID {database_schema_id}  in \"{database_name}\" found.", *args)
+class NoSuchBigSdbschemeException(BIGSDbDatabaseAPIException):
+    def __init__(self, database_name: str, database_scheme_id: int, *args):
+        super().__init__(f"No scheme with ID {database_scheme_id}  in \"{database_name}\" found.", *args)
--- a/src/autobigs/engine/reading.py
+++ b/src/autobigs/engine/reading.py
@ -1,5 +1,6 @@
 import asyncio
 from io import TextIOWrapper
+from os import path
 from typing import Any, AsyncGenerator, Iterable, Union
 from Bio import SeqIO

@ -9,9 +10,12 @@ async def read_fasta(handle: Union[str, TextIOWrapper]) -> Iterable[NamedString]
    fasta_sequences = asyncio.to_thread(SeqIO.parse, handle=handle, format="fasta")
    results = []
    for fasta_sequence in await fasta_sequences:
-        results.append(NamedString(fasta_sequence.id, str(fasta_sequence.seq)))
+        results.append(NamedString("{0}:{1}".format(path.basename(handle.name if isinstance(handle, TextIOWrapper) else handle), fasta_sequence.id), str(fasta_sequence.seq)))
    return results

 async def read_multiple_fastas(handles: Iterable[Union[str, TextIOWrapper]]) -> AsyncGenerator[Iterable[NamedString], Any]:
+    tasks = []
    for handle in handles:
-        yield await read_fasta(handle)
+        tasks.append(read_fasta(handle))
+    for task in asyncio.as_completed(tasks):
+        yield await task
--- a/src/autobigs/engine/structures/genomics.py
+++ b/src/autobigs/engine/structures/genomics.py
@ -25,7 +25,7 @@ class SangerTraceData(NamedString):
    analysis_proto_settings_name: str
    analysis_rpto_settings_ver: str
    analysis_proto_xml_data: str
-    analysis_proto_xml_schema_ver: str
+    analysis_proto_xml_scheme_ver: str
    sample_comment: Union[None, str]
    capillary_machine: bool
    container_identifier: str
--- a/src/autobigs/engine/writing.py
+++ b/src/autobigs/engine/writing.py
@ -1,9 +1,9 @@
 from collections import defaultdict
 import csv
 from os import PathLike
-from typing import AsyncIterable, Collection, Mapping, Sequence, Union
+from typing import AsyncIterable, Collection, Iterable, Mapping, Sequence, Union

-from autobigs.engine.structures.mlst import Allele, MLSTProfile
+from autobigs.engine.structures.mlst import Allele, MLSTProfile, NamedMLSTProfile


 def alleles_to_text_map(alleles: Collection[Allele]) -> Mapping[str, Union[Sequence[str], str]]:
@ -17,18 +17,20 @@ def alleles_to_text_map(alleles: Collection[Allele]) -> Mapping[str, Union[Seque
            result[locus] = tuple(result[locus]) # type: ignore
    return dict(result)

-async def write_mlst_profiles_as_csv(mlst_profiles_iterable: AsyncIterable[tuple[str, Union[MLSTProfile, None]]], handle: Union[str, bytes, PathLike[str], PathLike[bytes]]) -> Sequence[str]:
+async def write_mlst_profiles_as_csv(mlst_profiles_iterable: AsyncIterable[NamedMLSTProfile], handle: Union[str, bytes, PathLike[str], PathLike[bytes]], allele_names: Iterable[str]) -> Sequence[str]:
    failed = list()
    with open(handle, "w", newline='') as filehandle:
        header = None
        writer: Union[csv.DictWriter, None] = None
-        async for name, mlst_profile in mlst_profiles_iterable:
+        async for named_mlst_profile in mlst_profiles_iterable:
+            name = named_mlst_profile.name
+            mlst_profile = named_mlst_profile.mlst_profile
            if mlst_profile is None:
                failed.append(name)
                continue
            allele_mapping = alleles_to_text_map(mlst_profile.alleles)
            if writer is None:
-                header = ["id", "st", "clonal-complex", *sorted(allele_mapping.keys())]
+                header = ["id", "st", "clonal-complex", *sorted(allele_names)]
                writer = csv.DictWriter(filehandle, fieldnames=header)
                writer.writeheader()
            row_dictionary = {
--- a/tests/autobigs/engine/analysis/test_bigsdb.py
+++ b/tests/autobigs/engine/analysis/test_bigsdb.py
@ -7,7 +7,7 @@ import pytest
 from autobigs.engine.analysis import bigsdb
 from autobigs.engine.structures import mlst
 from autobigs.engine.structures.genomics import NamedString
-from autobigs.engine.structures.mlst import Allele, MLSTProfile
+from autobigs.engine.structures.mlst import Allele, MLSTProfile, NamedMLSTProfile
 from autobigs.engine.exceptions.database import NoBIGSdbExactMatchesException, NoBIGSdbMatchesException
 from autobigs.engine.analysis.bigsdb import BIGSdbIndex, BIGSdbMLSTProfiler, RemoteBIGSdbMLSTProfiler

@ -71,14 +71,14 @@ hinfluenzae_2014_102_bad_profile = MLSTProfile((
    ), "unknown", "unknown")


-@pytest.mark.parametrize("local_db,database_api,database_name,schema_id,seq_path,feature_seqs_path,expected_profile,bad_profile", [
+@pytest.mark.parametrize("local_db,database_api,database_name,scheme_id,seq_path,feature_seqs_path,expected_profile,bad_profile", [
    (False, "https://bigsdb.pasteur.fr/api", "pubmlst_bordetella_seqdef", 3, "tohama_I_bpertussis.fasta", "tohama_I_bpertussis_features.fasta", bpertussis_tohamaI_profile, bpertussis_tohamaI_bad_profile),
    (False, "https://rest.pubmlst.org", "pubmlst_hinfluenzae_seqdef", 1, "2014-102_hinfluenza.fasta", "2014-102_hinfluenza_features.fasta", hinfluenzae_2014_102_profile, hinfluenzae_2014_102_bad_profile),
 ])
 class TestBIGSdbMLSTProfiler:
-    async def test_profiling_results_in_exact_matches_when_exact(self, local_db, database_api, database_name, schema_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
+    async def test_profiling_results_in_exact_matches_when_exact(self, local_db, database_api, database_name, scheme_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
        sequence = get_first_sequence_from_fasta(seq_path)
-        async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, schema_id) as dummy_profiler:
+        async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, scheme_id) as dummy_profiler:
            expected_alleles = mlst.alleles_to_mapping(expected_profile.alleles)
            targets_left = set(mlst.alleles_to_mapping(expected_profile.alleles).keys())
            async for exact_match in dummy_profiler.determine_mlst_allele_variants(query_sequence_strings=[sequence]):
@ -89,10 +89,10 @@ class TestBIGSdbMLSTProfiler:

            assert len(targets_left) == 0

-    async def test_sequence_profiling_non_exact_returns_non_exact(self, local_db, database_api, database_name, schema_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
+    async def test_sequence_profiling_non_exact_returns_non_exact(self, local_db, database_api, database_name, scheme_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
        target_sequences = get_multiple_sequences_from_fasta(feature_seqs_path)
        mlst_targets = {x.lower() for x in mlst.alleles_to_mapping(expected_profile.alleles).keys()}
-        async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, schema_id) as profiler:
+        async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, scheme_id) as profiler:
            for target_sequence in target_sequences:
                match = re.fullmatch(r".*\[gene=([\w\d]+)\].*", target_sequence.description)
                if match is None:
@ -102,42 +102,54 @@ class TestBIGSdbMLSTProfiler:
                    continue
                scrambled = gene_scrambler(str(target_sequence.seq), 0.125)
                async for partial_match in profiler.determine_mlst_allele_variants([scrambled]):
+                    assert isinstance(partial_match, Allele)
                    assert partial_match.partial_match_profile is not None
                    mlst_targets.remove(gene)

            assert len(mlst_targets) == 0

-    async def test_profiling_results_in_correct_mlst_st(self, local_db, database_api, database_name, schema_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
-        async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, schema_id) as dummy_profiler:
+    async def test_profiling_results_in_correct_mlst_st(self, local_db, database_api, database_name, scheme_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
+        async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, scheme_id) as dummy_profiler:
            mlst_st_data = await dummy_profiler.determine_mlst_st(expected_profile.alleles)
            assert mlst_st_data is not None
            assert isinstance(mlst_st_data, MLSTProfile)
            assert mlst_st_data.clonal_complex == expected_profile.clonal_complex
            assert mlst_st_data.sequence_type == expected_profile.sequence_type

-    async def test_profiling_non_exact_results_in_list_of_mlsts(self, local_db, database_api, database_name, schema_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
+    async def test_profiling_non_exact_results_in_list_of_mlsts(self, local_db, database_api, database_name, scheme_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
        dummy_alleles = bad_profile.alleles
-        async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, schema_id) as dummy_profiler:
+        async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, scheme_id) as dummy_profiler:
            mlst_profile = await dummy_profiler.determine_mlst_st(dummy_alleles)
+            assert isinstance(mlst_profile, MLSTProfile)
            assert mlst_profile.clonal_complex == "unknown"
            assert mlst_profile.sequence_type == "unknown"


-    async def test_bigsdb_profile_multiple_strings_same_string_twice(self, local_db, database_api, database_name, schema_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
+    async def test_bigsdb_profile_multiple_strings_same_string_twice(self, local_db, database_api, database_name, scheme_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
        sequence = get_first_sequence_from_fasta(seq_path)
        dummy_sequences = [[NamedString("seq1", sequence)], [NamedString("seq2", sequence)]]
-        async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, schema_id) as dummy_profiler:
+        async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, scheme_id) as dummy_profiler:
            async for named_profile in dummy_profiler.profile_multiple_strings(generate_async_iterable(dummy_sequences)):
                name, profile = named_profile.name, named_profile.mlst_profile
-                assert profile is not None
                assert isinstance(profile, MLSTProfile)
                assert profile.clonal_complex == expected_profile.clonal_complex
                assert profile.sequence_type == expected_profile.sequence_type

-    async def test_bigsdb_profile_multiple_strings_exactmatch_fail_second_no_stop(self, local_db, database_api, database_name, schema_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
+    async def test_bigsdb_profile_named_string_no_repeat_name(self, local_db, database_api, database_name, scheme_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
+        sequence = get_first_sequence_from_fasta(seq_path)
+        async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, scheme_id) as dummy_profiler:
+            named_profile = await dummy_profiler.profile_string([NamedString("BX470248.1", sequence)])
+            assert isinstance(named_profile, NamedMLSTProfile)
+            name, profile = named_profile.name, named_profile.mlst_profile
+            assert isinstance(profile, MLSTProfile)
+            assert profile.clonal_complex == expected_profile.clonal_complex
+            assert profile.sequence_type == expected_profile.sequence_type
+            assert name == "BX470248.1"
+
+    async def test_bigsdb_profile_multiple_strings_exactmatch_fail_second_no_stop(self, local_db, database_api, database_name, scheme_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
        valid_seq = get_first_sequence_from_fasta(seq_path)
        dummy_sequences = [[NamedString("seq1", valid_seq)], [NamedString("should_fail", gene_scrambler(valid_seq, 0.3))], [NamedString("seq3", valid_seq)]]
-        async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, schema_id) as dummy_profiler:
+        async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, scheme_id) as dummy_profiler:
            async for name_profile in dummy_profiler.profile_multiple_strings(generate_async_iterable(dummy_sequences), True):
                name, profile = name_profile.name, name_profile.mlst_profile

@ -151,11 +163,11 @@ class TestBIGSdbMLSTProfiler:
                    assert profile.clonal_complex == expected_profile.clonal_complex
                    assert profile.sequence_type == expected_profile.sequence_type

-    async def test_bigsdb_profile_multiple_strings_nonexact_second_no_stop(self, local_db, database_api, database_name, schema_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
+    async def test_bigsdb_profile_multiple_strings_nonexact_second_no_stop(self, local_db, database_api, database_name, scheme_id, seq_path: str, feature_seqs_path: str, expected_profile: MLSTProfile, bad_profile: MLSTProfile):
        valid_seq = get_first_sequence_from_fasta(seq_path)
        dummy_sequences = [[NamedString("seq1", valid_seq)], [NamedString("should_fail", gene_scrambler(valid_seq, 0.3))], [NamedString("seq3", valid_seq)]]

-        async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, schema_id) as dummy_profiler:
+        async with bigsdb.get_BIGSdb_MLST_profiler(local_db, database_api, database_name, scheme_id) as dummy_profiler:
            async for named_profile in dummy_profiler.profile_multiple_strings(generate_async_iterable(dummy_sequences), False):
                name, profile = named_profile.name, named_profile.mlst_profile
                
@ -183,12 +195,12 @@ class TestBIGSdbIndex:
        async with BIGSdbIndex() as bigsdb_index:
            assert (await bigsdb_index.get_bigsdb_api_from_seqdefdb("pubmlst_bordetella_seqdef")) == "https://bigsdb.pasteur.fr/api"

-    async def test_bigsdb_index_get_schemas_for_bordetella(self):
+    async def test_bigsdb_index_get_schemes_for_bordetella(self):
        async with BIGSdbIndex() as index:
-            schemas = await index.get_schemas_for_seqdefdb(seqdef_db_name="pubmlst_bordetella_seqdef")
-            assert len(schemas.keys()) > 0
-            assert "MLST" in schemas
-            assert isinstance(schemas["MLST"], int)
+            schemes = await index.get_schemes_for_seqdefdb(seqdef_db_name="pubmlst_bordetella_seqdef")
+            assert len(schemes.keys()) > 0
+            assert "MLST" in schemes
+            assert isinstance(schemes["MLST"], int)

    async def test_bigsdb_index_get_databases_has_only_seqdef(self):
        async with BIGSdbIndex() as index:
@ -207,5 +219,15 @@ class TestBIGSdbIndex:
            async with await bigsdb_index.build_profiler_from_seqdefdb(local, "pubmlst_bordetella_seqdef", 3) as profiler:
                assert isinstance(profiler, BIGSdbMLSTProfiler)
                profile = await profiler.profile_string(sequence)
+                assert isinstance(profile, MLSTProfile)
                assert profile.clonal_complex == "ST-2 complex"
                assert profile.sequence_type == "1"
+
+
+    @pytest.mark.parametrize(["bigsdb_name", "scheme_id", "expected"], [
+        ("pubmlst_bordetella_seqdef", 3, ["adk", "fumC", "glyA", "tyrB", "icd", "pepA", "pgm"])
+    ])
+    async def test_bigsdb_index_fetches_loci_names(self, bigsdb_name, scheme_id, expected):
+        async with BIGSdbIndex() as bigsdb_index:
+            loci = await bigsdb_index.get_scheme_loci(bigsdb_name, scheme_id)
+            assert set(loci) == set(expected)
--- a/tests/autobigs/engine/test_reading.py
+++ b/tests/autobigs/engine/test_reading.py
@ -4,4 +4,9 @@ from autobigs.engine.reading import read_fasta
 async def test_fasta_reader_not_none():
    named_strings = await read_fasta("tests/resources/tohama_I_bpertussis.fasta")
    for named_string in named_strings:
-        assert named_string.name == "BX470248.1"
+        assert named_string.name is not None
+
+async def test_fasta_reader_name_contains_file_and_id():
+    named_strings = await read_fasta("tests/resources/tohama_I_bpertussis.fasta")
+    for named_string in named_strings:
+        assert named_string.name == "tohama_I_bpertussis.fasta:BX470248.1"
--- a/tests/autobigs/engine/test_writing.py
+++ b/tests/autobigs/engine/test_writing.py
@ -3,7 +3,7 @@ from typing import AsyncIterable, Iterable
 import pytest
 from autobigs.engine.structures.alignment import AlignmentStats
 from autobigs.engine.writing import alleles_to_text_map, write_mlst_profiles_as_csv
-from autobigs.engine.structures.mlst import Allele, MLSTProfile
+from autobigs.engine.structures.mlst import Allele, MLSTProfile, NamedMLSTProfile
 import tempfile
 from csv import reader
 from os import path
@ -11,31 +11,44 @@ from os import path

@pytest.fixture
 def dummy_alphabet_mlst_profile():
-    return MLSTProfile((
+    return NamedMLSTProfile("name", MLSTProfile((
        Allele("A", "1", None),
        Allele("D", "1", None),
        Allele("B", "1", None),
        Allele("C", "1", None),
        Allele("C", "2", AlignmentStats(90, 10, 0, 90))
-    ), "mysterious", "very mysterious")
+    ), "mysterious", "very mysterious"))

 async def iterable_to_asynciterable(iterable: Iterable):
    for iterated in iterable:
        yield iterated

 async def test_column_order_is_same_as_expected_file(dummy_alphabet_mlst_profile: MLSTProfile):
-    dummy_profiles = [("test_1", dummy_alphabet_mlst_profile)]
+    dummy_profiles = [dummy_alphabet_mlst_profile]
    with tempfile.TemporaryDirectory() as temp_dir:
        output_path = path.join(temp_dir, "out.csv")
-        await write_mlst_profiles_as_csv(iterable_to_asynciterable(dummy_profiles), output_path)
+        await write_mlst_profiles_as_csv(iterable_to_asynciterable(dummy_profiles), output_path, ["A", "D", "B", "C"])
        with open(output_path) as csv_handle:
            csv_reader = reader(csv_handle)
            lines = list(csv_reader)
-            target_columns = lines[4:]
+            target_columns = lines[0][3:]
            assert target_columns == sorted(target_columns)

-async def test_alleles_to_text_map_mapping_is_correct(dummy_alphabet_mlst_profile: MLSTProfile):
-    mapping = alleles_to_text_map(dummy_alphabet_mlst_profile.alleles)
+async def test_csv_writing_sample_name_not_repeated_when_single_sequence(dummy_alphabet_mlst_profile):
+    dummy_profiles = [dummy_alphabet_mlst_profile]
+    with tempfile.TemporaryDirectory() as temp_dir:
+        output_path = path.join(temp_dir, "out.csv")
+        await write_mlst_profiles_as_csv(iterable_to_asynciterable(dummy_profiles), output_path, ["A", "D", "B", "C"])
+        with open(output_path) as csv_handle:
+            csv_reader = reader(csv_handle)
+            lines = list(csv_reader)
+            sample_name = lines[1][0]
+            assert sample_name == "name"
+
+
+async def test_alleles_to_text_map_mapping_is_correct(dummy_alphabet_mlst_profile: NamedMLSTProfile):
+    assert dummy_alphabet_mlst_profile.mlst_profile is not None
+    mapping = alleles_to_text_map(dummy_alphabet_mlst_profile.mlst_profile.alleles)
    expected_mapping = {
        "A": "1",
        "B": "1",
@ -45,3 +58,13 @@ async def test_alleles_to_text_map_mapping_is_correct(dummy_alphabet_mlst_profil
    for allele_name, allele_ids in mapping.items():
        assert allele_name in expected_mapping
        assert allele_ids == expected_mapping[allele_name]
+
+async def test_csv_writing_includes_asterisk_for_non_exact(dummy_alphabet_mlst_profile: NamedMLSTProfile):
+    dummy_profiles = [dummy_alphabet_mlst_profile]
+    with tempfile.TemporaryDirectory() as temp_dir:
+        output_path = path.join(temp_dir, "out.csv")
+        await write_mlst_profiles_as_csv(iterable_to_asynciterable(dummy_profiles), output_path, ["A", "D", "B", "C"])
+        with open(output_path) as csv_handle:
+            csv_reader = reader(csv_handle)
+            lines = list(csv_reader)
+            assert '*' in lines[1][5]
--- a/tests/resources/12822_bpertussis.fasta
+++ b/tests/resources/12822_bpertussis.fasta
--- a/tests/resources/B3913_bpertussis_minimized_features.fasta
+++ b/tests/resources/B3913_bpertussis_minimized_features.fasta
@ -0,0 +1,133 @@
+>lcl|CP011447.1_gene_2762 [gene=adk] [locus_tag=B3913_2762] [location=2916440..2917096] [gbkey=Gene]
+ATGCGTCTCATTCTGCTCGGACCGCCCGGAGCCGGCAAAGGCACCCAAGCCGCCTTTCTCACCCAACACT
+ACGGCATCCCGCAGATATCCACCGGTGACATGCTGCGCGCCGCCGTCAAGGCCGGCACGCCGCTGGGCCT
+GGAAGCCAAGAAGGTCATGGACGCGGGCGGCCTGGTCTCGGACGACCTGATCATCGGCCTGGTGCGCGAT
+CGCCTGACCCAGCCCGATTGCGCCAACGGCTACCTGTTCGACGGTTTCCCGCGCACCATCCCGCAGGCCG
+ACGCGCTCAAGAGCGCCGGCATCGCGCTGGATTACGTGGTCGAGATCGAAGTGCCGGAAAGCGACATCAT
+CGAACGCATGAGCGAACGCCGCGTGCACCCGGCCAGCGGCCGCAGCTACCACGTACGCTTCAATCCGCCC
+AAGGCCGAAGGCGTGGACGACGTCACGGGCGAACCGCTGGTGCAGCGCGACGACGACCGCGAGGAAACCG
+TGCGCCATCGTCTCAACGTCTACCAGAACCAGACCCGCCCGCTGGTCGACTACTACTCGTCCTGGGCCCA
+GTCCGATGCCGCCGCGGCGCCCAAGTACCGCAAGATCTCCGGCGTCGGCTCGGTCGACGAAATCAAGAGC
+CGCCTGTCGCAGGCTCTGCAGAGCTAA
+>lcl|CP011447.1_gene_253 [gene=fumC] [locus_tag=B3913_0253] [location=257438..258829] [gbkey=Gene]
+ATGAAAACCCGCACCGAAAAAGACACTTTCGGCCCGATCGAGGTGCCCGAGCAGCACCTGTGGGGCGCGC
+AGACCCAGCGCTCGCTGCATTTCTTCGCGATCTCGACCGAGAAGATGCCGGTGCCGCTGGTCGCCGCCAT
+GGCACGCCTGAAGCGCGCCGCCGCCAAGGTCAACGCCGAGCTGGGCGAGCTGGATCCGCAGGTCGCAGAC
+GCCATCATGCGGGCCGCCGATGAGGTGATCGCCGGCAAGTGGCCCGACGAGTTTCCGCTGTCGGTCTGGC
+AGACCGGCTCGGGCACGCAGAGCAACATGAACATGAACGAGGTGCTGGCCAACCGCGCCTCCGAGCTGCT
+GGGCGGCGAGCGCGGCGAAGGCCGCAAGGTGCACCCCAACGACCACGTGAACCGGGGCCAGTCGTCCAAC
+GATACCTTTCCGACCGCCATGCACGTGGCCGCCGCGGTCGAGGTCGAGCACCGCGTGCTGCCCGCCCTGA
+AGGCGTTGCGCGGCACGCTGGCCGCCAAGAGCGCGGCGTTCTACGACATCGTCAAGATCGGTCGCACCCA
+TTTGCAGGACGCCACCCCGTTGACGCTGGGCCAGGAGATCTCCGGCTACGTGGCGCAGCTGGACCTGGCC
+GAGCAGCAGATCCGCGCGACGCTGGCCGGCCTGCACCAGCTGGCCATCGGCGGCACGGCGGTGGGCACCG
+GCCTGAACGCGCATCCGCAGTTCAGCGCCAAGGTATCGGCCGAACTGGCCCATGACACGGGCAGCGCGTT
+CGTGTCGGCGCCCAACAAGTTCCAGGCGCTGGCTTCGCACGAGGCGCTGCTGTTCGCGCACGGCGCCTTG
+AAGACGCTGGCCGCCGGCCTGATGAAGATCGCCAACGATGTGCGCTGGCTGGCCAGCGGCCCGCGCTCGG
+GGCTGGGCGAAATCAGCATTCCCGAGAACGAGCCGGGCAGCTCCATCATGCCGGGCAAGGTCAACCCGAC
+CCAGTGCGAAGCCGTCACGATGCTGGCCGCGCAGGTCATGGGCAACGACGTGGCCATCAATGTCGGCGGG
+GCCAGCGGCAACTTCGAGCTGAACGTCTTCAAGCCGCTGGTGATCCACAATTTCCTGCAGTCGGTGCGCC
+TGCTGGCCGACGGCATGGTCAGCTTCGACAAGCACTGCGCGGCCGGCATCGAGCCCAACCGCGAGCGCAT
+CACCGAGCTGGTCGAGCGTTCGCTGATGCTGGTGACTGCGCTCAACCCGCACATCGGCTACGACAAGGCC
+GCGCAGATCGCCAAGAAGGCGCACAAGGAAAACCTGTCGCTGAAAGAGGCGGCGCTGGCGCTGGGGCACC
+TGACCGAGGCGCAGTTCGCCGAGTGGGTGGTGCCGGGCGACATGACCAACGCGCGCCGCTAG
+>lcl|CP011447.1_gene_2963 [gene=glyA] [locus_tag=B3913_2963] [location=complement(3129365..3130612)] [gbkey=Gene]
+ATGTTCAACCGCAACCTGACCCTCGACCAGGTGGATCCCGACGTCTGGGCCGCCATCCAGAAAGAAGACG
+TACGCCAGGAACAGCACATCGAGCTGATCGCGTCCGAGAACTACGCCAGCCCCGCCGTGATGCAGGCCCA
+GGGCACGCAACTGACCAACAAGTATGCGGAAGGCTACCCGGGCAAGCGCTACTACGGCGGTTGCGAGTAC
+GTCGACGTGGTCGAGCAGCTGGCCATCGACCGCCTGAAGCAGATTTTCGGCGCCGAGGCCGCCAACGTGC
+AGCCGAACTCCGGCTCGCAGGCCAACCAGGGCGTGTACATGGCGGTGCTCAAGCCGGGCGATACCGTGCT
+GGGCATGAGCCTGGCCGAAGGCGGTCACCTGACGCACGGCGCGTCGGTCAACGCCTCGGGCAAGCTGTAC
+AACTTCGTGCCCTACGGCCTGGACGCCGACGAGGTGCTGGACTACGCCCAGGTCGAGCGGCTGACCAAGG
+AACACAAGCCCAAGCTGATCGTGGCCGGCGCCTCCGCGTACGCGCTGCACATCGACTTCGAGCGCATGGC
+GCGCATCGCCCACGACAACGGCGCGCTGTTCATGGTGGACATCGCCCACTATGCCGGCCTGGTGGCCGGC
+GGCGCCTATCCCAACCCGGTGCCGCACGCCGATTTCGTCACCTCCACCACGCACAAGTCGCTGCGCGGCC
+CGCGCGGCGGCGTCATCATGATGAAGGCCGAGTTCGAGAAGGCCGTCAATTCGGCCATCTTCCCGGGCAT
+CCAGGGCGGTCCGCTGATGCACGTCATCGCGGCCAAGGCCGTGGCCTTCAAGGAAGCGCTGTCGCCCGAG
+TTCCAGGATTACGCCCAGCAGGTCGTCAAGAACGCCAAGGTGCTGGCCGATACGCTGGTCAAGCGCGGCC
+TGCGCATCGTGTCGGGCAGGACCGAAAGCCACGTCATGCTGGTGGACCTGCGTCCCAAGGGCATTACCGG
+CAAGGAAGCGGAAGCGGTGCTGGGCCAGGCCCACATCACGGTCAACAAGAACGCCATTCCCAACGACCCG
+GAAAAGCCCTTCGTGACCAGCGGCATCCGCCTGGGCACTCCGGCCATGACCACCCGCGGCTTCAAGGAGG
+CCGAGGCCGAGCTGACCGCCAACCTGATCGCCGACGTGCTGGACAATCCGCGCGACGAGGCGAACATCGC
+CGCGGTGCGCGCGCGGGTCAATGAACTGACCGCCCGCCTGCCCGTCTACGGCAACTGA
+>lcl|CP011447.1_gene_2473 [gene=icd] [locus_tag=B3913_2473] [location=complement(2605674..2606930)] [gbkey=Gene]
+ATGTCCTATCAACATATCAAGGTTCCCACTGGGGGCCAAAAAATCACGGTCAACGCCGATTACTCGCTGA
+ATGTGCCCGATCAGGTCATCATTCCGGTCATCGAGGGTGACGGTACGGGCGCCGACATCACGCCGGTGAT
+GATTAAGGTCGTCGACGCGGCCGTGCAGAAGGCCTATGCGGGCAAGCGCAAGATCCACTGGATGGAAGTC
+TACGCCGGCGAGAAGGCCACCAAGGTCTACGGCCCGGACGTCTGGCTGCCCGAGGAAACCCTCGACGCCG
+TCAAGGACTACGTGGTGTCGATCAAGGGTCCGCTGACCACGCCGGTCGGCGGCGGCATCCGTTCGCTGAA
+CGTGGCGCTGCGCCAGCAGCTGGACCTGTATGTCTGCCTGCGCCCGGTGCGCTACTTCAAGGGCGTGCCC
+TCGCCGGTGCGCGAGCCCGAGAAGACCGACATGGTCATCTTCCGCGAGAACTCGGAAGACATCTACGCGG
+GCATCGAGTACATGGCCGAGTCCGAGCAGGCCAAGGACCTGATCCAGTACCTGCAGACCAAGCTGGGCGT
+GACCAAGATCCGCTTCCCGAACACCTCGTCGATCGGCATCAAGCCGGTTTCGCGCGAAGGCACCGAGCGC
+CTGGTGCGCAAGGCGCTGCAGTACGCCATCGACAATGACCGCGCCTCGGTGACCCTGGTCCACAAGGGCA
+ACATCATGAAGTTCACGGAAGGCGGCTTCCGCGACTGGGGCTACGCCCTGGCCCAGAACGAGTTCGGCGC
+GCAGCCGATCGACGGCGGCCCGTGGTGCAAGTTCAAGAATCCCAAGACGGGTCGCGAGATCATCGTCAAG
+GATTCGATCGCCGACGCCTTCCTGCAGCAGATCCTGCTGCGTCCGGCCGAATACGACGTGATCGCCACGC
+TGAACCTGAACGGCGACTACATCTCCGACGCGCTGGCCGCGCAAGTGGGCGGCATCGGCATTGCCCCGGG
+CGCCAACCTGTCGGATTCCGTGGCCATGTTCGAAGCCACCCACGGCACCGCGCCGAAGTACGCGGGCAAG
+GACTACGTGAACCCCGGTTCCGAAATCCTGTCGGCCGAAATGATGCTGCGCCACATGGGCTGGACCGAGG
+CCGCCGACCTGATCATCGCCAGCATGGAGAAATCCATCCTGTCCAAGAAGGTCACCTATGACTTCGCCCG
+TCTGCTCGAAGGCGCCACCCAGGTGTCGTGCTCGGGCTTCGGTCAGGTCATGATCGACAATATGTAA
+>lcl|CP011447.1_gene_2403 [gene=pepA] [locus_tag=B3913_2403] [location=2531836..2533335] [gbkey=Gene]
+ATGGAATTTAGCACACAGACCACTGCCTCCCTGCATCAGATCAAGACTGCGGCCCTGGCCGTCGGCGTCT
+TCGCCGACGGCGTGCTCAGCGCCGCCGCCGAAGTCATCGACCGCGCCAGCCACGGTGCCGTGGCCGCCGT
+GGTGAAAAGCGAGTTCCGCGGCCGCACCGGCAGCACGCTGGTGCTGCGCAGCCTGGCCGGCGTCAGCGCC
+CAGCGCGTGGTGCTGGTGGGCCTGGGCAAGCAGGCCGAATACAACGCCCGCGCGCACGCCAGCGCCGAAC
+AGGCGTTCGCCGCGGCGTGCGTCGCGGCCCAGGTGGGCGAAGGCGTGTCGACCCTGGCCGGCGTGGCCAT
+CGAGGGCGTGCCGGTGCGCGCCCGCGCGCGCAGCGCCGCCATCGCCGCGGGCGCGGCGGCCTACCATTAC
+GATGCGACGTTCGGCAAGGCCAATCGCGACGCCCGCCCCAGGTTGAAGAAAATCGTCCAGGTGGTCGACC
+GCGCGGCCTCCGCGCAGGCGCAGCTGGGCCTGCGCGAAGGCGCGGCCATCGCCCACGGCATGGAATTGAC
+CCGCACGCTGGGCAACCTGCCCGGCAACGTGTGCACGCCGGCCTATCTCGGCAATACCGCCAAGAAACTG
+GCGCGCGAATTCAAGAGCCTCAAGGTCGAGGTGCTCGAACGCAAGCAGGTCGAGGCGCTGGGCATGGGCT
+CGTTCCTCTCGGTCGCGCGCGGCTCGGAAGAACCGCTGCGCTTCATCGTGCTGCGCCATGCCGGCAAGCC
+CGCCAAGAAGGACAAGGCCGGCCCGGTCGTCCTGGTGGGCAAGGGCATCACCTTCGATGCTGGCGGCATC
+TCGCTCAAGCCGGCCGCCACGATGGACGAAATGAAGTACGACATGTGCGGCGCGGCCAGCGTGCTGGGCA
+CGTTCCGCGCCCTGGCCGAGCTGGAGCTGCCGCTGGATGTGGTGGGCCTGATCGCGGCGTGCGAGAACCT
+GCCCAGCGGCAAGGCCAACAAGCCCGGCGACGTGGTCACCAGCATGTCGGGCCAGACCATCGAGATCCTC
+AACACCGACGCCGAAGGCCGCCTGGTGCTGTGCGATGCCCTGACCTACGCCGAGCGCTTCAAGCCCGCGG
+CCGTGATCGACATCGCCACGTTGACCGGCGCCTGCGTGGTAGCCCTGGGCAACGTCAATAGCGGCCTGTT
+CTCCAAGGACGACGCGCTGGCCGACGCGCTGCTGGCCGCCAGCCGCCAGTCGCTCGACCCGGCCTGGCGC
+CTGCCGCTGGACGATGCCTACCAGGACCAGCTCAAGTCCAACTTCGCCGACATCGCCAACATCGGCGGCC
+CCCCGGCCGGCGCGGTCACGGCGGCCTGCTTCCTGTCGCGCTTCACCAAGGCTTATCCGTGGGCGCACCT
+GGACATCGCCGGCACGGCCTGGCGCGGCGGCAAGGACAAGGGCGCCACCGGCCGGCCGGTGCCGCTGCTG
+ATGCAGTACCTGCTGGACCAGGCAGGCTGA
+>lcl|CP011447.1_gene_3165 [gene=pgm] [locus_tag=B3913_3165] [location=3355021..3356403] [gbkey=Gene]
+GTGGCGCACCCCTTTCCCGCATCGGTCTACAAGGCGTACGACATCCGTGGCTCGGTTCCCGACCAGCTCG
+ACCCGGTATTCGCCCGGGCGCTGGGCCGCGCCCTGGCCGCCAGCGCCCGCGCGCAGGGCATCGGCGCCCT
+GGTGGTCGGCCGCGACGGCCGCCTGAGCAGCCCCGACCTGGCCGGCGCGCTGCAGGAAGGCATCATGGAA
+GGCGGCGTGGACACCCTGGACATCGGCCAGGTGCCCACGCCGCTGGTCTATTTCGCGGCGCACATCCAGG
+GCACGGGCTCGGGCGTGGCGGTCACCGGCAGCCACAACCCGCCGCAGTACAACGGCTTCAAGATGATGAT
+GGGCGGCCAGGCCCTGTACGGCCCGGCCGTGCAGGCGCTGCGCCCGGCCATGCTGGCGCCGGCTGCGGCG
+CCGGGCACCTGGGGCGAACGCCGCCAGCTCGATGTCGTCCCCGCCTATATCGAGCGCATCGTGTCCGACG
+TGAAGCTGGCGCGCCCCATGAAGATCGCCGTCGACTGCGGCAATGGCGTGGCCGGCGCCCTGGCGCCGCA
+ACTGTTCCGCGCGCTGGGTTGCGAAGTGGACGAGCTCTATTGCGAGGTCGACGGCACGTTTCCCAACCAC
+CATCCCGACCCGGCCGAACCGCGCAACCTGCAGGACCTGATCGCCCATGTCACCAGCACCGACTGCGAGC
+TGGGCCTGGCCTTCGACGGCGACGGCGACCGCCTCGGCGTGGTGACCAAGTCCGGCCAGATCATCTGGCC
+CGACCGCCAGCTGATCCTGTTCGCCCGCGACGTGCTGGCCCGCTGTCCCGGCGCGACCATCATCTATGAC
+GTCAAGTGCAGCCAGCACGTGGGCGTGGCCATCGAGCAAAGCGGCGGCGTGCCGCTGATGTGGCAGACTG
+GCCATTCGCTGGTGAAGGCCAAGCTGGCCGAGACCGGCGCGCCGCTGGCCGGCGAGATGAGCGGCCATAT
+CTTCTTCAAGGAGCGCTGGTACGGCTTCGACGACGGCCTGTACACCGGCGCCCGCCTGCTGGAAATCGTC
+TCCCGCGAAACCGATGCGTCGCGCCCGCTGGAGGCCCTGCCGCAGGCGCTGTCGACCCCCGAGCTCAAGC
+TGGAGATGGCCGAGGGCGAGCCGCATGCGCTGATCGCCGCCCTGCAGCAGCAGGGCGAGTTCGCCAGCGC
+CAGCCGGCTGGTTACGATAGACGGCGTGCGCGCGGAATACCCGGACGGCTTCGGGCTGGCGCGCGCCTCC
+AATACCACCCCCGTCGTCGTGCTGCGCTTCGAAGCGGAGACCGAGCCGGGCCTGGCCCGCATCCAGCAGG
+AATTCCGCCAGCAGCTGCTGCGGCTGGCTCCGCAAGCCAAACTGCCCTTCTGA
+>lcl|CP011447.1_gene_2110 [gene=tyrB] [locus_tag=B3913_2110] [location=2214524..2215726] [gbkey=Gene]
+ATGAGCACTCTTTTCGCTTCCGTCGAACTCGCGCCGCGCGACCCCATTCTTGGCCTGAACGAACAGTACA
+ACGCCGATACCCGTCCCGGCAAAGTGAACCTGGGCGTGGGCGTGTACTACGACGACGAAGGCCGCATCCC
+GCTGCTTCAGGCCGTGCGCAAGGCCGAGGTGGCCCGCATCGAAGCCGCCGCCGCCCGCGGCTATCTGCCG
+ATCGAAGGCATCGCGGGGTACAACAAGGGTGCGCAGGCGCTGCTGCTGGGCGCCGACTCGCCGCTGGCCG
+CCGAAGGCCGCGTGCTGACCGCGCAGGCCCTGGGCGGCACCGGCGCGCTGAAGATCGGCGCCGACTTCCT
+GCGCCAGCTGCTGCCGCAGTCCAAGGTCCTCATCAGCGACCCCAGCTGGGAAAACCACCGCGCCCTGTTC
+GAGCGCGCCGGCTTCCCGGTCGAGACCTACGCTTATTACGATGCCGCCACCCATGGCCTGAACTTCGAAG
+CCATGCTGGCCGCCCTGCAGGCCGCGCCCGAACAGACCATCGTGGTGCTGCACGCCTGCTGCCACAACCC
+GACCGGCGTCGATCCCACGCCGCAACAGTGGGAACAGATCGCCGCCGTGGTCAAGGCGCGCAACCTGGTG
+CCGTTCCTCGACATCGCCTACCAGGGCTTCGGCGAAGGCCTGGAGCAGGACGCCGCCGTGGTGCGCATGT
+TCGCCGAGCTCGACCTGACCATGTTCATCAGCTCGTCGTTCTCCAAGTCCTTCTCGCTGTATGGCGAGCG
+GGTCGGGGCCCTGACCGTGGTGGCCGGCAGCAAGGACGAGGCCGCCCGCGTGCTCAGCCAGCTCAAGCGC
+GTGATCCGCACCAACTACTCCAACCCGCCCACCCACGGCGGCACCGTGGTGTCCACGGTCCTGAACACAC
+CCGAGCTGTTCGCGCTCTGGGAAAATGAACTGGCCGGCATGCGCGACCGCATCCGCCTGATGCGCAAGGA
+GCTGGTCGAGAAGATCAAGACCCAGGGCGTGGCGCAGGACTTCAGCTTCGTGCTGGCGCAGCGCGGCATG
+TTCTCGTACTCGGGCCTGACCGCCGCCCAGGTCGATCGCCTGCGCGAAGAGCACGGCATCTACGCGGTCT
+CCAGCGGCCGCATCTGCGTGGCCGCGCTCAACAGCCGCAACATCGACGCGGTCGCGGCCGGCATCGCCGC
+GGTGCTGAAGTAG
--- a/tests/resources/B3921_bpertussis_minimized_features.fasta
+++ b/tests/resources/B3921_bpertussis_minimized_features.fasta
@ -0,0 +1,133 @@
+>lcl|CP011448.1_cds_ALH77808.1_2459 [gene=adk] [locus_tag=B3921_2764] [protein=adenylate kinase] [protein_id=ALH77808.1] [location=2918521..2919177] [gbkey=CDS]
+ATGCGTCTCATTCTGCTCGGACCGCCCGGAGCCGGCAAAGGCACCCAAGCCGCCTTTCTCACCCAACACT
+ACGGCATCCCGCAGATATCCACCGGTGACATGCTGCGCGCCGCCGTCAAGGCCGGCACGCCGCTGGGCCT
+GGAAGCCAAGAAGGTCATGGACGCGGGCGGCCTGGTCTCGGACGACCTGATCATCGGCCTGGTGCGCGAT
+CGCCTGACCCAGCCCGATTGCGCCAACGGCTACCTGTTCGACGGTTTCCCGCGCACCATCCCGCAGGCCG
+ACGCGCTCAAGAGCGCCGGCATCGCGCTGGATTACGTGGTCGAGATCGAAGTGCCGGAAAGCGACATCAT
+CGAACGCATGAGCGAACGCCGCGTGCACCCGGCCAGCGGCCGCAGCTACCACGTACGCTTCAATCCGCCC
+AAGGCCGAAGGCGTGGACGACGTCACGGGCGAACCGCTGGTGCAGCGCGACGACGACCGCGAGGAAACCG
+TGCGCCATCGTCTCAACGTCTACCAGAACCAGACCCGCCCGCTGGTCGACTACTACTCGTCCTGGGCCCA
+GTCCGATGCCGCCGCGGCGCCCAAGTACCGCAAGATCTCCGGCGTCGGCTCGGTCGACGAAATCAAGAGC
+CGCCTGTCGCAGGCTCTGCAGAGCTAA
+>lcl|CP011448.1_cds_ALH75563.1_214 [gene=fumC] [locus_tag=B3921_0253] [protein=fumarate hydratase] [protein_id=ALH75563.1] [location=257428..258819] [gbkey=CDS]
+ATGAAAACCCGCACCGAAAAAGACACTTTCGGCCCGATCGAGGTGCCCGAGCAGCACCTGTGGGGCGCGC
+AGACCCAGCGCTCGCTGCATTTCTTCGCGATCTCGACCGAGAAGATGCCGGTGCCGCTGGTCGCCGCCAT
+GGCACGCCTGAAGCGCGCCGCCGCCAAGGTCAACGCCGAGCTGGGCGAGCTGGATCCGCAGGTCGCAGAC
+GCCATCATGCGGGCCGCCGATGAGGTGATCGCCGGCAAGTGGCCCGACGAGTTTCCGCTGTCGGTCTGGC
+AGACCGGCTCGGGCACGCAGAGCAACATGAACATGAACGAGGTGCTGGCCAACCGCGCCTCCGAGCTGCT
+GGGCGGCGAGCGCGGCGAAGGCCGCAAGGTGCACCCCAACGACCACGTGAACCGGGGCCAGTCGTCCAAC
+GATACCTTTCCGACCGCCATGCACGTGGCCGCCGCGGTCGAGGTCGAGCACCGCGTGCTGCCCGCCCTGA
+AGGCGTTGCGCGGCACGCTGGCCGCCAAGAGCGCGGCGTTCTACGACATCGTCAAGATCGGTCGCACCCA
+TTTGCAGGACGCCACCCCGTTGACGCTGGGCCAGGAGATCTCCGGCTACGTGGCGCAGCTGGACCTGGCC
+GAGCAGCAGATCCGCGCGACGCTGGCCGGCCTGCACCAGCTGGCCATCGGCGGCACGGCGGTGGGCACCG
+GCCTGAACGCGCATCCGCAGTTCAGCGCCAAGGTATCGGCCGAACTGGCCCATGACACGGGCAGCGCGTT
+CGTGTCGGCGCCCAACAAGTTCCAGGCGCTGGCTTCGCACGAGGCGCTGCTGTTCGCGCACGGCGCCTTG
+AAGACGCTGGCCGCCGGCCTGATGAAGATCGCCAACGATGTGCGCTGGCTGGCCAGCGGCCCGCGCTCGG
+GGCTGGGCGAAATCAGCATTCCCGAGAACGAGCCGGGCAGCTCCATCATGCCGGGCAAGGTCAACCCGAC
+CCAGTGCGAAGCCGTCACGATGCTGGCCGCGCAGGTCATGGGCAACGACGTGGCCATCAATGTCGGCGGG
+GCCAGCGGCAACTTCGAGCTGAACGTCTTCAAGCCGCTGGTGATCCACAATTTCCTGCAGTCGGTGCGCC
+TGCTGGCCGACGGCATGGTCAGCTTCGACAAGCACTGCGCGGCCGGCATCGAGCCCAACCGCGAGCGCAT
+CACCGAGCTGGTCGAGCGTTCGCTGATGCTGGTGACTGCGCTCAACCCGCACATCGGCTACGACAAGGCC
+GCGCAGATCGCCAAGAAGGCGCACAAGGAAAACCTGTCGCTGAAAGAGGCGGCGCTGGCGCTGGGGCACC
+TGACCGAGGCGCAGTTCGCCGAGTGGGTGGTGCCGGGCGACATGACCAACGCGCGCCGCTAG
+>lcl|CP011448.1_cds_ALH77981.1_2632 [gene=glyA] [locus_tag=B3921_2965] [protein=serine hydroxymethyltransferase] [protein_id=ALH77981.1] [location=complement(3131372..3132619)] [gbkey=CDS]
+ATGTTCAACCGCAACCTGACCCTCGACCAGGTGGATCCCGACGTCTGGGCCGCCATCCAGAAAGAAGACG
+TACGCCAGGAACAGCACATCGAGCTGATCGCGTCCGAGAACTACGCCAGCCCCGCCGTGATGCAGGCCCA
+GGGCACGCAACTGACCAACAAGTATGCGGAAGGCTACCCGGGCAAGCGCTACTACGGCGGTTGCGAGTAC
+GTCGACGTGGTCGAGCAGCTGGCCATCGACCGCCTGAAGCAGATTTTCGGCGCCGAGGCCGCCAACGTGC
+AGCCGAACTCCGGCTCGCAGGCCAACCAGGGCGTGTACATGGCGGTGCTCAAGCCGGGCGATACCGTGCT
+GGGCATGAGCCTGGCCGAAGGCGGTCACCTGACGCACGGCGCGTCGGTCAACGCCTCGGGCAAGCTGTAC
+AACTTCGTGCCCTACGGCCTGGACGCCGACGAGGTGCTGGACTACGCCCAGGTCGAGCGGCTGACCAAGG
+AACACAAGCCCAAGCTGATCGTGGCCGGCGCCTCCGCGTACGCGCTGCACATCGACTTCGAGCGCATGGC
+GCGCATCGCCCACGACAACGGCGCGCTGTTCATGGTGGACATCGCCCACTATGCCGGCCTGGTGGCCGGC
+GGCGCCTATCCCAACCCGGTGCCGCACGCCGATTTCGTCACCTCCACCACGCACAAGTCGCTGCGCGGCC
+CGCGCGGCGGCGTCATCATGATGAAGGCCGAGTTCGAGAAGGCCGTCAATTCGGCCATCTTCCCGGGCAT
+CCAGGGCGGTCCGCTGATGCACGTCATCGCGGCCAAGGCCGTGGCCTTCAAGGAAGCGCTGTCGCCCGAG
+TTCCAGGATTACGCCCAGCAGGTCGTCAAGAACGCCAAGGTGCTGGCCGATACGCTGGTCAAGCGCGGCC
+TGCGCATCGTGTCGGGCAGGACCGAAAGCCACGTCATGCTGGTGGACCTGCGTCCCAAGGGCATTACCGG
+CAAGGAAGCGGAAGCGGTGCTGGGCCAGGCCCACATCACGGTCAACAAGAACGCCATTCCCAACGACCCG
+GAAAAGCCCTTCGTGACCAGCGGCATCCGCCTGGGCACTCCGGCCATGACCACCCGCGGCTTCAAGGAGG
+CCGAGGCCGAGCTGACCGCCAACCTGATCGCCGACGTGCTGGACAATCCGCGCGACGAGGCGAACATCGC
+CGCGGTGCGCGCGCGGGTCAATGAACTGACCGCCCGCCTGCCCGTCTACGGCAACTGA
+>lcl|CP011448.1_cds_ALH77547.1_2198 [gene=icd] [locus_tag=B3921_2474] [protein=isocitrate dehydrogenase] [protein_id=ALH77547.1] [location=complement(2606706..2607962)] [gbkey=CDS]
+ATGTCCTATCAACATATCAAGGTTCCCACTGGGGGCCAAAAAATCACGGTCAACGCCGATTACTCGCTGA
+ATGTGCCCGATCAGGTCATCATTCCGGTCATCGAGGGTGACGGTACGGGCGCCGACATCACGCCGGTGAT
+GATTAAGGTCGTCGACGCGGCCGTGCAGAAGGCCTATGCGGGCAAGCGCAAGATCCACTGGATGGAAGTC
+TACGCCGGCGAGAAGGCCACCAAGGTCTACGGCCCGGACGTCTGGCTGCCCGAGGAAACCCTCGACGCCG
+TCAAGGACTACGTGGTGTCGATCAAGGGTCCGCTGACCACGCCGGTCGGCGGCGGCATCCGTTCGCTGAA
+CGTGGCGCTGCGCCAGCAGCTGGACCTGTATGTCTGCCTGCGCCCGGTGCGCTACTTCAAGGGCGTGCCC
+TCGCCGGTGCGCGAGCCCGAGAAGACCGACATGGTCATCTTCCGCGAGAACTCGGAAGACATCTACGCGG
+GCATCGAGTACATGGCCGAGTCCGAGCAGGCCAAGGACCTGATCCAGTACCTGCAGACCAAGCTGGGCGT
+GACCAAGATCCGCTTCCCGAACACCTCGTCGATCGGCATCAAGCCGGTTTCGCGCGAAGGCACCGAGCGC
+CTGGTGCGCAAGGCGCTGCAGTACGCCATCGACAATGACCGCGCCTCGGTGACCCTGGTCCACAAGGGCA
+ACATCATGAAGTTCACGGAAGGCGGCTTCCGCGACTGGGGCTACGCCCTGGCCCAGAACGAGTTCGGCGC
+GCAGCCGATCGACGGCGGCCCGTGGTGCAAGTTCAAGAATCCCAAGACGGGTCGCGAGATCATCGTCAAG
+GATTCGATCGCCGACGCCTTCCTGCAGCAGATCCTGCTGCGTCCGGCCGAATACGACGTGATCGCCACGC
+TGAACCTGAACGGCGACTACATCTCCGACGCGCTGGCCGCGCAAGTGGGCGGCATCGGCATTGCCCCGGG
+CGCCAACCTGTCGGATTCCGTGGCCATGTTCGAAGCCACCCACGGCACCGCGCCGAAGTACGCGGGCAAG
+GACTACGTGAACCCCGGTTCCGAAATCCTGTCGGCCGAAATGATGCTGCGCCACATGGGCTGGACCGAGG
+CCGCCGACCTGATCATCGCCAGCATGGAGAAATCCATCCTGTCCAAGAAGGTCACCTATGACTTCGCCCG
+TCTGCTCGAAGGCGCCACCCAGGTGTCGTGCTCGGGCTTCGGTCAGGTCATGATCGACAATATGTAA
+>lcl|CP011448.1_cds_ALH77480.1_2131 [gene=pepA] [locus_tag=B3921_2404] [protein=leucyl aminopeptidase] [protein_id=ALH77480.1] [location=2532868..2534367] [gbkey=CDS]
+ATGGAATTTAGCACACAGACCACTGCCTCCCTGCATCAGATCAAGACTGCGGCCCTGGCCGTCGGCGTCT
+TCGCCGACGGCGTGCTCAGCGCCGCCGCCGAAGTCATCGACCGCGCCAGCCACGGTGCCGTGGCCGCCGT
+GGTGAAAAGCGAGTTCCGCGGCCGCACCGGCAGCACGCTGGTGCTGCGCAGCCTGGCCGGCGTCAGCGCC
+CAGCGCGTGGTGCTGGTGGGCCTGGGCAAGCAGGCCGAATACAACGCCCGCGCGCACGCCAGCGCCGAAC
+AGGCGTTCGCCGCGGCGTGCGTCGCGGCCCAGGTGGGCGAAGGCGTGTCGACCCTGGCCGGCGTGGCCAT
+CGAGGGCGTGCCGGTGCGCGCCCGCGCGCGCAGCGCCGCCATCGCCGCGGGCGCGGCGGCCTACCATTAC
+GATGCGACGTTCGGCAAGGCCAATCGCGACGCCCGCCCCAGGTTGAAGAAAATCGTCCAGGTGGTCGACC
+GCGCGGCCTCCGCGCAGGCGCAGCTGGGCCTGCGCGAAGGCGCGGCCATCGCCCACGGCATGGAATTGAC
+CCGCACGCTGGGCAACCTGCCCGGCAACGTGTGCACGCCGGCCTATCTCGGCAATACCGCCAAGAAACTG
+GCGCGCGAATTCAAGAGCCTCAAGGTCGAGGTGCTCGAACGCAAGCAGGTCGAGGCGCTGGGCATGGGCT
+CGTTCCTCTCGGTCGCGCGCGGCTCGGAAGAACCGCTGCGCTTCATCGTGCTGCGCCATGCCGGCAAGCC
+CGCCAAGAAGGACAAGGCCGGCCCGGTCGTCCTGGTGGGCAAGGGCATCACCTTCGATGCTGGCGGCATC
+TCGCTCAAGCCGGCCGCCACGATGGACGAAATGAAGTACGACATGTGCGGCGCGGCCAGCGTGCTGGGCA
+CGTTCCGCGCCCTGGCCGAGCTGGAGCTGCCGCTGGATGTGGTGGGCCTGATCGCGGCGTGCGAGAACCT
+GCCCAGCGGCAAGGCCAACAAGCCCGGCGACGTGGTCACCAGCATGTCGGGCCAGACCATCGAGATCCTC
+AACACCGACGCCGAAGGCCGCCTGGTGCTGTGCGATGCCCTGACCTACGCCGAGCGCTTCAAGCCCGCGG
+CCGTGATCGACATCGCCACGTTGACCGGCGCCTGCGTGGTAGCCCTGGGCAACGTCAATAGCGGCCTGTT
+CTCCAAGGACGACGCGCTGGCCGACGCGCTGCTGGCCGCCAGCCGCCAGTCGCTCGACCCGGCCTGGCGC
+CTGCCGCTGGACGATGCCTACCAGGACCAGCTCAAGTCCAACTTCGCCGACATCGCCAACATCGGCGGCC
+CCCCGGCCGGCGCGGTCACGGCGGCCTGCTTCCTGTCGCGCTTCACCAAGGCTTATCCGTGGGCGCACCT
+GGACATCGCCGGCACGGCCTGGCGCGGCGGCAAGGACAAGGGCGCCACCGGCCGGCCGGTGCCGCTGCTG
+ATGCAGTACCTGCTGGACCAGGCAGGCTGA
+>lcl|CP011448.1_cds_ALH78163.1_2814 [gene=pgm] [locus_tag=B3921_3166] [protein=phosphoglucomutase] [protein_id=ALH78163.1] [location=3355979..3357361] [gbkey=CDS]
+GTGGCGCACCCCTTTCCCGCATCGGTCTACAAGGCGTACGACATCCGTGGCTCGGTTCCCGACCAGCTCG
+ACCCGGTATTCGCCCGGGCGCTGGGCCGCGCCCTGGCCGCCAGCGCCCGCGCGCAGGGCATCGGCGCCCT
+GGTGGTCGGCCGCGACGGCCGCCTGAGCAGCCCCGACCTGGCCGGCGCGCTGCAGGAAGGCATCATGGAA
+GGCGGCGTGGACACCCTGGACATCGGCCAGGTGCCCACGCCGCTGGTCTATTTCGCGGCGCACATCCAGG
+GCACGGGCTCGGGCGTGGCGGTCACCGGCAGCCACAACCCGCCGCAGTACAACGGCTTCAAGATGATGAT
+GGGCGGCCAGGCCCTGTACGGCCCGGCCGTGCAGGCGCTGCGCCCGGCCATGCTGGCGCCGGCTGCGGCG
+CCGGGCACCTGGGGCGAACGCCGCCAGCTCGATGTCGTCCCCGCCTATATCGAGCGCATCGTGTCCGACG
+TGAAGCTGGCGCGCCCCATGAAGATCGCCGTCGACTGCGGCAATGGCGTGGCCGGCGCCCTGGCGCCGCA
+ACTGTTCCGCGCGCTGGGTTGCGAAGTGGACGAGCTCTATTGCGAGGTCGACGGCACGTTTCCCAACCAC
+CATCCCGACCCGGCCGAACCGCGCAACCTGCAGGACCTGATCGCCCATGTCACCAGCACCGACTGCGAGC
+TGGGCCTGGCCTTCGACGGCGACGGCGACCGCCTCGGCGTGGTGACCAAGTCCGGCCAGATCATCTGGCC
+CGACCGCCAGCTGATCCTGTTCGCCCGCGACGTGCTGGCCCGCTGTCCCGGCGCGACCATCATCTATGAC
+GTCAAGTGCAGCCAGCACGTGGGCGTGGCCATCGAGCAAAGCGGCGGCGTGCCGCTGATGTGGCAGACTG
+GCCATTCGCTGGTGAAGGCCAAGCTGGCCGAGACCGGCGCGCCGCTGGCCGGCGAGATGAGCGGCCATAT
+CTTCTTCAAGGAGCGCTGGTACGGCTTCGACGACGGCCTGTACACCGGCGCCCGCCTGCTGGAAATCGTC
+TCCCGCGAAACCGATGCGTCGCGCCCGCTGGAGGCCCTGCCGCAGGCGCTGTCGACCCCCGAGCTCAAGC
+TGGAGATGGCCGAGGGCGAGCCGCATGCGCTGATCGCCGCCCTGCAGCAGCAGGGCGAGTTCGCCAGCGC
+CAGCCGGCTGGTTACGATAGACGGCGTGCGCGCGGAATACCCGGACGGCTTCGGGCTGGCGCGCGCCTCC
+AATACCACCCCCGTCGTCGTGCTGCGCTTCGAAGCGGAGACCGAGCCGGGCCTGGCCCGCATCCAGCAGG
+AATTCCGCCAGCAGCTGCTGCGGCTGGCTCCGCAAGCCAAACTGCCCTTCTGA
+>lcl|CP011448.1_cds_ALH77215.1_1866 [gene=tyrB] [locus_tag=B3921_2112] [protein=aromatic amino acid aminotransferase] [protein_id=ALH77215.1] [location=2216606..2217808] [gbkey=CDS]
+ATGAGCACTCTTTTCGCTTCCGTCGAACTCGCGCCGCGCGACCCCATTCTTGGCCTGAACGAACAGTACA
+ACGCCGATACCCGTCCCGGCAAAGTGAACCTGGGCGTGGGCGTGTACTACGACGACGAAGGCCGCATCCC
+GCTGCTTCAGGCCGTGCGCAAGGCCGAGGTGGCCCGCATCGAAGCCGCCGCCGCCCGCGGCTATCTGCCG
+ATCGAAGGCATCGCGGGGTACAACAAGGGTGCGCAGGCGCTGCTGCTGGGCGCCGACTCGCCGCTGGCCG
+CCGAAGGCCGCGTGCTGACCGCGCAGGCCCTGGGCGGCACCGGCGCGCTGAAGATCGGCGCCGACTTCCT
+GCGCCAGCTGCTGCCGCAGTCCAAGGTCCTCATCAGCGACCCCAGCTGGGAAAACCACCGCGCCCTGTTC
+GAGCGCGCCGGCTTCCCGGTCGAGACCTACGCTTATTACGATGCCGCCACCCATGGCCTGAACTTCGAAG
+CCATGCTGGCCGCCCTGCAGGCCGCGCCCGAACAGACCATCGTGGTGCTGCACGCCTGCTGCCACAACCC
+GACCGGCGTCGATCCCACGCCGCAACAGTGGGAACAGATCGCCGCCGTGGTCAAGGCGCGCAACCTGGTG
+CCGTTCCTCGACATCGCCTACCAGGGCTTCGGCGAAGGCCTGGAGCAGGACGCCGCCGTGGTGCGCATGT
+TCGCCGAGCTCGACCTGACCATGTTCATCAGCTCGTCGTTCTCCAAGTCCTTCTCGCTGTATGGCGAGCG
+GGTCGGGGCCCTGACCGTGGTGGCCGGCAGCAAGGACGAGGCCGCCCGCGTGCTCAGCCAGCTCAAGCGC
+GTGATCCGCACCAACTACTCCAACCCGCCCACCCACGGCGGCACCGTGGTGTCCACGGTCCTGAACACAC
+CCGAGCTGTTCGCGCTCTGGGAAAATGAACTGGCCGGCATGCGCGACCGCATCCGCCTGATGCGCAAGGA
+GCTGGTCGAGAAGATCAAGACCCAGGGCGTGGCGCAGGACTTCAGCTTCGTGCTGGCGCAGCGCGGCATG
+TTCTCGTACTCGGGCCTGACCGCCGCCCAGGTCGATCGCCTGCGCGAAGAGCACGGCATCTACGCGGTCT
+CCAGCGGCCGCATCTGCGTGGCCGCGCTCAACAGCCGCAACATCGACGCGGTCGCGGCCGGCATCGCCGC
+GGTGCTGAAGTAG
Author	SHA1	Message	Date
Harrison Deng	f8d92a4aad	Added predetermined headers feature All checks were successful autoBIGS.engine/pipeline/head This commit looks good Details	2025-03-14 14:26:43 +00:00
Harrison Deng	34bf02c75a	Increased timeout to 5 minutes Some checks reported errors autoBIGS.engine/pipeline/tag Something is wrong with the build of this commit Details autoBIGS.engine/pipeline/head There was a failure building this commit Details	2025-03-13 18:37:33 +00:00
Harrison Deng	3cb10a4609	Added client error as acceptable exception All checks were successful autoBIGS.engine/pipeline/head This commit looks good Details	2025-03-13 18:13:38 +00:00
Harrison Deng	1776f5aa51	Fixed exception syntax All checks were successful autoBIGS.engine/pipeline/head This commit looks good Details	2025-03-13 16:51:15 +00:00
Harrison Deng	96d715fdcb	Added a server disconnect error catch All checks were successful autoBIGS.engine/pipeline/head This commit looks good Details	2025-03-13 16:27:59 +00:00
Harrison Deng	e088d1080b	Added functionality to retry determining ST Some checks reported errors autoBIGS.engine/pipeline/head Something is wrong with the build of this commit Details	2025-03-13 16:13:14 +00:00
Harrison Deng	8ffc7c7fb5	Added retry functionality for allele variant determination All checks were successful autoBIGS.engine/pipeline/head This commit looks good Details	2025-03-13 15:54:35 +00:00
Harrison Deng	af7edf0942	Changed development server publication condition Some checks failed autoBIGS.engine/pipeline/tag This commit looks good Details autoBIGS.engine/pipeline/head There was a failure building this commit Details	2025-03-13 14:37:16 +00:00
Harrison Deng	481870db97	Updated tests to reflect new fasta read naming All checks were successful autoBIGS.engine/pipeline/head This commit looks good Details	2025-03-13 14:25:44 +00:00
Harrison Deng	62fdada9c1	Added original filename to csv output Some checks reported errors autoBIGS.engine/pipeline/head Something is wrong with the build of this commit Details	2025-03-13 14:17:08 +00:00
Harrison Deng	3074997db6	Removed unused file	2025-03-13 14:01:00 +00:00
Harrison Deng	3d6f36a722	Added test for non-exact allele matches All checks were successful autoBIGS.engine/pipeline/head This commit looks good Details	2025-02-28 15:05:26 +00:00
Harrison Deng	bbd9e67c8c	Added test to check CSV name is not repeated All checks were successful autoBIGS.engine/pipeline/head This commit looks good Details	2025-02-26 07:10:44 +00:00
Harrison Deng	2ea2f63f29	Pipeline will now only publish to git.reslate.systems on main branch All checks were successful autoBIGS.engine/pipeline/tag This commit looks good Details autoBIGS.engine/pipeline/head This commit looks good Details	2025-02-26 06:31:53 +00:00
Harrison Deng	17932ecd71	Alleles IDs obtained from one sequence is named the ID of that sequence Some checks failed autoBIGS.engine/pipeline/head There was a failure building this commit Details Instead of generating a tuple comprised of the one sequence ID repeated	2025-02-26 06:15:56 +00:00
Harrison Deng	6cdc4ff4ae	Merge branch 'develop' Some checks reported errors autoBIGS.engine/pipeline/tag Something is wrong with the build of this commit Details autoBIGS.engine/pipeline/head This commit looks good Details	2025-02-26 05:26:12 +00:00
Harrison Deng	4b34036d17	Fixed concurrent profile_multiple_strings implementation All checks were successful autoBIGS.engine/pipeline/head This commit looks good Details	2025-02-26 05:16:24 +00:00
Harrison Deng	27ae89fde7	Replaced schema with scheme All checks were successful autoBIGS.engine/pipeline/head This commit looks good Details	2025-02-26 04:50:54 +00:00
Harrison Deng	06dbb56c28	Revert "Recipe meta.yaml also archived as artifact" All checks were successful autoBIGS.engine/pipeline/head This commit looks good Details This reverts commit 79fcce8b8401554f69376f79787a786e5a97f31c.	2025-02-21 06:34:59 +00:00
Harrison Deng	79fcce8b84	Recipe meta.yaml also archived as artifact Some checks reported errors autoBIGS.engine/pipeline/head Something is wrong with the build of this commit Details	2025-02-21 06:22:27 +00:00
Harrison Deng	f4064f087e	Fixed typos in pipeline script All checks were successful autoBIGS.engine/pipeline/head This commit looks good Details	2025-02-21 06:12:35 +00:00
Harrison Deng	276665f5fd	Added curl to environment requirements All checks were successful autoBIGS.engine/pipeline/head This commit looks good Details	2025-02-21 06:01:39 +00:00
Harrison Deng	fd536862e2	Twine version specified to 6.0.1 to avoid Twine issue 15611 Some checks failed autoBIGS.engine/pipeline/head There was a failure building this commit Details	2025-02-21 05:53:08 +00:00
Harrison Deng	576dc303f4	Changed requested kubernetes container to be miniforge	2025-02-21 05:52:34 +00:00
Harrison Deng	2822a483e3	Initial attempt at switching to a conda based build environment Some checks failed autoBIGS.engine/pipeline/head There was a failure building this commit Details	2025-02-21 05:37:56 +00:00
Harrison Deng	b8cebb8ba4	Infrastructure for concurrent processing implemented All checks were successful autoBIGS.engine/pipeline/head This commit looks good Details	2025-02-19 15:49:46 +00:00
Harrison Deng	62ce1c9b2f	Updated README.md to explain versioning All checks were successful automlst.engine/pipeline/head This commit looks good Details	2025-02-18 16:32:02 +00:00
Harrison Deng	7384895578	Writing now uses named MLST profile All checks were successful automlst.engine/pipeline/head This commit looks good Details automlst.engine/pipeline/tag This commit looks good Details	2025-02-18 16:03:17 +00:00
Harrison Deng	5a03c7e8d8	Multiple string profiling now respects grouped queries (for non-WGS) All checks were successful automlst.engine/pipeline/head This commit looks good Details	2025-02-18 15:34:18 +00:00
Harrison Deng	ddf9cde175	Added a license text to pyproject.toml	2025-02-14 20:47:06 +00:00
Harrison Deng	2e8cdd8da9	Updated URL links All checks were successful automlst.engine/pipeline/head This commit looks good Details autoBIGS.engine/pipeline/tag This commit looks good Details	2025-02-14 20:37:13 +00:00